ID: 1016858320

View in Genome Browser
Species Human (GRCh38)
Location 6:148694390-148694412
Sequence CCTAGGCGTAAGGCAGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016858314_1016858320 22 Left 1016858314 6:148694345-148694367 CCAAGTATTCTTTCAGTCATTGT No data
Right 1016858320 6:148694390-148694412 CCTAGGCGTAAGGCAGCACTTGG No data
1016858315_1016858320 -1 Left 1016858315 6:148694368-148694390 CCAGTTAAAAATGTCCATCTCAC No data
Right 1016858320 6:148694390-148694412 CCTAGGCGTAAGGCAGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016858320 Original CRISPR CCTAGGCGTAAGGCAGCACT TGG Intergenic
No off target data available for this crispr