ID: 1016860372

View in Genome Browser
Species Human (GRCh38)
Location 6:148711979-148712001
Sequence CAGAGTCACCAATTGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016860372_1016860376 -5 Left 1016860372 6:148711979-148712001 CCCACCCTCAATTGGTGACTCTG No data
Right 1016860376 6:148711997-148712019 CTCTGCCTTATTTTTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016860372 Original CRISPR CAGAGTCACCAATTGAGGGT GGG (reversed) Intergenic
No off target data available for this crispr