ID: 1016860970

View in Genome Browser
Species Human (GRCh38)
Location 6:148718497-148718519
Sequence GAGGAAACGTTCAGTCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016860964_1016860970 13 Left 1016860964 6:148718461-148718483 CCACAGGCTGTACAGGAAGCATG 0: 551
1: 972
2: 1130
3: 804
4: 686
Right 1016860970 6:148718497-148718519 GAGGAAACGTTCAGTCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016860970 Original CRISPR GAGGAAACGTTCAGTCATGA TGG Intergenic
No off target data available for this crispr