ID: 1016871327

View in Genome Browser
Species Human (GRCh38)
Location 6:148819985-148820007
Sequence CCATGGGGGCCTCTCTCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016871315_1016871327 25 Left 1016871315 6:148819937-148819959 CCACGAGCTGCTATTTCTTTCTA 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1016871327 6:148819985-148820007 CCATGGGGGCCTCTCTCTCCGGG No data
1016871317_1016871327 -5 Left 1016871317 6:148819967-148819989 CCGAAGGCCCATCTGTACCCATG 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1016871327 6:148819985-148820007 CCATGGGGGCCTCTCTCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016871327 Original CRISPR CCATGGGGGCCTCTCTCTCC GGG Intronic
No off target data available for this crispr