ID: 1016872636

View in Genome Browser
Species Human (GRCh38)
Location 6:148834018-148834040
Sequence ATGCTGTTATTGAAACAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016872635_1016872636 3 Left 1016872635 6:148833992-148834014 CCGTCTTGTTTTTTGTTCATAAA 0: 1
1: 0
2: 6
3: 56
4: 891
Right 1016872636 6:148834018-148834040 ATGCTGTTATTGAAACAATATGG 0: 1
1: 0
2: 1
3: 19
4: 270
1016872634_1016872636 11 Left 1016872634 6:148833984-148834006 CCTTTTCACCGTCTTGTTTTTTG 0: 1
1: 0
2: 0
3: 31
4: 376
Right 1016872636 6:148834018-148834040 ATGCTGTTATTGAAACAATATGG 0: 1
1: 0
2: 1
3: 19
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016872636 Original CRISPR ATGCTGTTATTGAAACAATA TGG Intronic
902959667 1:19954119-19954141 ATTCTGTTACTGAAACACCAGGG + Intergenic
904943862 1:34184753-34184775 CTACTGTTATTTAAACAATTAGG + Intronic
905238283 1:36565448-36565470 AAGCTATTATGGAAACAAGATGG - Intergenic
905959727 1:42033600-42033622 ATGCTGTTATTCCACCAATGAGG + Intronic
909171794 1:72304634-72304656 ATCCTCTTATTGGAACAATGAGG + Intergenic
909502882 1:76354903-76354925 AAGCTTTTATTGAAATAAGAGGG + Intronic
909753798 1:79197438-79197460 TTGTTGTTATTGAAGCAGTATGG + Intergenic
909791964 1:79691244-79691266 ATCCTGCCATTGCAACAATATGG - Intergenic
909889760 1:80989994-80990016 ATTTTGTTCTGGAAACAATAGGG - Intergenic
910036453 1:82794917-82794939 TTACTGTTTTTGAAAAAATATGG - Intergenic
910617002 1:89209416-89209438 ATTCTGTTATGGAAACACCATGG - Intergenic
911214008 1:95172313-95172335 ATGCTTTTATTTAAACAAGATGG - Intronic
911896438 1:103441360-103441382 ATGCTGTCCTTCAAACTATAAGG - Intergenic
912278929 1:108292187-108292209 ATATTGTTATTAAAAGAATATGG - Intergenic
912289297 1:108402170-108402192 ATATTGTTATTAAAAGAATATGG + Intronic
912761153 1:112368595-112368617 AATGTGTTATTGAAACAAAAAGG + Intergenic
912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG + Intergenic
915828594 1:159104246-159104268 CCCCTGATATTGAAACAATATGG + Intronic
919439763 1:197617206-197617228 GTGCTATTATTGAAAAAAGAGGG + Intronic
920531103 1:206703232-206703254 AAACTGGTATTTAAACAATAAGG + Intronic
921724114 1:218505692-218505714 GTGTTGTTTTTGAAACATTAGGG + Intergenic
922445724 1:225695477-225695499 ATGTTGTTAATGAAAAACTAGGG - Intergenic
922687097 1:227649018-227649040 ATTCTGCTATTTAAACAACATGG - Intronic
923765946 1:236892546-236892568 ATGCTGTTATGGTAAAAATATGG - Intronic
1063494651 10:6495655-6495677 ATGCTGTCATTGGAAGAATGCGG + Intronic
1064494358 10:15892680-15892702 ATGCTGTTACTGGAAAAAAAGGG + Intergenic
1065064307 10:21944546-21944568 ATACTGTGATTGATACAATTAGG - Intronic
1065396059 10:25239297-25239319 CAGCTGTGATTAAAACAATAGGG + Intronic
1065469633 10:26064404-26064426 ATGATGTTAGAGAAATAATAGGG + Intronic
1066521042 10:36219560-36219582 CTGCTGTTCTTGAAACATAAGGG + Intergenic
1066597576 10:37068347-37068369 ATGCGGTTATTGTAACATTCAGG + Intergenic
1067111312 10:43403015-43403037 ATTCTGTTTTTGAAAAGATAGGG + Intronic
1069230128 10:65998202-65998224 ATGCTGTTCTTGTATCAAAATGG - Intronic
1071093481 10:81947057-81947079 ATGCTGTCTCTGAAACTATAGGG + Intronic
1073666325 10:105538434-105538456 ATGCTGTGATGGAAATAACAGGG + Intergenic
1073720506 10:106164791-106164813 ATGTTGTTATTGATATAATTGGG - Intergenic
1073803244 10:107066950-107066972 GAGCTGTGATTGACACAATAGGG - Intronic
1076771509 10:132668363-132668385 ATGCTGCCATGGAAAAAATATGG + Intronic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1079387271 11:19991537-19991559 AAGCTGTTATAGAAATAAAAGGG - Intronic
1079405812 11:20144720-20144742 ATGTCTTTCTTGAAACAATATGG + Intergenic
1080355066 11:31433923-31433945 ATACTGTTATTGAGACACAAGGG - Intronic
1081048522 11:38307967-38307989 ATTCTCTTGTTGAAACCATATGG + Intergenic
1082963263 11:58939436-58939458 AAGCTGTTACTGAAACACCAGGG - Intronic
1085358123 11:75858418-75858440 ATGCTGTCTATGAACCAATATGG - Intronic
1086025723 11:82288647-82288669 CAGCTGCTATGGAAACAATATGG - Intergenic
1086153287 11:83637598-83637620 ATGATGTCATGGAAACAAAATGG - Intronic
1087126689 11:94634963-94634985 ATGCTGTCACTGAAACCAAATGG + Intergenic
1087346660 11:96980247-96980269 ATGCTCTTCTGGAAATAATAAGG - Intergenic
1089803400 11:121058510-121058532 ATTCCTTTAATGAAACAATAAGG - Intronic
1093526812 12:20113198-20113220 AAGCTGTTATTGAAACACCAGGG - Intergenic
1093860717 12:24163186-24163208 ATTCAGTTAATGACACAATAGGG + Intergenic
1095301946 12:40594802-40594824 ATCCTGTCATTGTAACAATATGG - Intergenic
1097998217 12:65913629-65913651 AGGGTGTAATTGAAAGAATATGG + Intronic
1098582705 12:72120024-72120046 ATGCTATTATTGATAAAGTAAGG + Intronic
1099616462 12:84941713-84941735 ATTCTGTCATTGCAACAACATGG + Intergenic
1099910071 12:88820262-88820284 ATTGTGTTACTGAAACACTAGGG + Intergenic
1100721545 12:97364397-97364419 ATGGTGTTATGGAAAGAACATGG + Intergenic
1101093287 12:101309818-101309840 ATCCTGTTATTGAACTCATAAGG + Exonic
1101819325 12:108171355-108171377 ATGGTGTAATTGTAGCAATATGG - Intronic
1101850178 12:108395400-108395422 ATGCTAATATAGAAAGAATAAGG + Intergenic
1102202554 12:111067741-111067763 ATGATGTTCTTCAAACAACAGGG - Intronic
1102531777 12:113551913-113551935 ATGCTGTTATGGAAAGAAACAGG - Intergenic
1102634423 12:114310563-114310585 ATGCTGTTTTTGAAAGAAGAGGG + Intergenic
1104084666 12:125463316-125463338 ATCCTTTTATTGTCACAATAGGG + Intronic
1104552280 12:129768291-129768313 CAGCTGCTATGGAAACAATATGG - Intronic
1107254568 13:38408392-38408414 ATGCTGTTATTAAATCATCATGG + Intergenic
1107622060 13:42243764-42243786 ATGCTGTTGCTGAAACATAAGGG + Intronic
1108328982 13:49365987-49366009 ATTCTGTCATTGCAACAACATGG + Intronic
1108945999 13:56024951-56024973 ATGCTGCTAATGCAACACTAGGG + Intergenic
1109092417 13:58065038-58065060 ATGCTATTATGAAAACAAGATGG - Intergenic
1110171413 13:72505385-72505407 ATCCTATTAATGCAACAATAAGG + Intergenic
1113044854 13:106145065-106145087 AACTTGTTTTTGAAACAATAAGG - Intergenic
1114886790 14:26862397-26862419 AAGCTATCATTTAAACAATAAGG + Intergenic
1115408076 14:33041589-33041611 ATACTGTTACCGAAACACTAGGG + Intronic
1115503420 14:34069950-34069972 ATGCAGTAATTAAAACAATGTGG - Intronic
1117131607 14:52692946-52692968 ATTCTATAAGTGAAACAATAGGG - Intronic
1117660682 14:58001163-58001185 ATTCTGTCATTGTGACAATATGG - Exonic
1118101021 14:62602395-62602417 CAGCTGTTATAGAAACACTATGG + Intergenic
1119958361 14:78825522-78825544 ATGCTGGTATGGAAAACATATGG - Intronic
1120926151 14:89799543-89799565 ATGCTGTAACAGAAACAAGAGGG - Intronic
1130085252 15:80772628-80772650 ATGTTGTCATTGAAACCATGAGG + Intergenic
1130381123 15:83373324-83373346 ATATTGTTATTGAACCAATTAGG + Intergenic
1130750711 15:86709708-86709730 ATGGTGTGATGGAAACCATATGG + Intronic
1130832832 15:87619077-87619099 ATGCAGTTAAGGAAACAAAAAGG + Intergenic
1133610600 16:7429785-7429807 TTGCTGTTAGGGAAATAATAGGG - Intronic
1138069715 16:53980804-53980826 ATGCCGCTATTAAAAAAATAAGG - Intronic
1139084831 16:63572169-63572191 ATGCTGCTTTTGAAAGAAAATGG + Intergenic
1140788826 16:78369830-78369852 GTGCTGTAATGGAAACCATAAGG + Intronic
1143929838 17:10411016-10411038 ATTCTTTTATTGAAAAAATGTGG + Intronic
1144028956 17:11302811-11302833 AGGTTGCTATAGAAACAATATGG + Intronic
1149181470 17:53942845-53942867 GTGCTGTTATTAAAACCACAAGG - Intergenic
1149260422 17:54874551-54874573 ATGCTGTGAAAGAAACAAAAAGG + Intergenic
1150051333 17:61966939-61966961 AAGCTTTTATTCAAACAAAATGG - Intronic
1155846147 18:30709158-30709180 ATGCTGTTAATTATACAATTGGG + Intergenic
1156065971 18:33142939-33142961 ATGCTTTTGTTAAAAAAATATGG - Intronic
1156518454 18:37700787-37700809 ATGCTGTTATTGAACCATTTAGG + Intergenic
1157206956 18:45708956-45708978 AAGCTGTTACTGAAACACCAGGG + Intergenic
1157486620 18:48092065-48092087 ATGCTGATATTGCAATAATAAGG + Intronic
1158826046 18:61220787-61220809 CTGCTGTTGTTGAATGAATATGG - Intergenic
1158997250 18:62934831-62934853 AAGCTGTTAATAAAAAAATAAGG + Intronic
1159433969 18:68391857-68391879 AAGCTGTTACTGAAACACCAAGG - Intergenic
1159984981 18:74831268-74831290 ATGCTTTTATCCAAACAAAAGGG - Intronic
1160037801 18:75317586-75317608 ATGCCGTTATTGATACACTCCGG + Intergenic
1160174789 18:76584270-76584292 CAGCTGTGATTGAAACAAAAGGG + Intergenic
1164799690 19:31066415-31066437 AAGCAGTTATTTAAACAAGAGGG - Intergenic
1167629249 19:50614138-50614160 ATGATCTTTTTGAATCAATAGGG + Intergenic
1168012838 19:53547340-53547362 ATCCTGTTATTGTGACAACATGG - Intronic
926353779 2:12021371-12021393 ATTTTGTTATTGAAACACTAGGG - Intergenic
926384528 2:12323302-12323324 ATGCTGTAATGGAAAAAAAAAGG - Intergenic
926691280 2:15735784-15735806 ATACTGTTATTCAAATAACAAGG - Intronic
926984568 2:18608640-18608662 ATGCTTTTAATGAAATAAAATGG - Intergenic
927092104 2:19719940-19719962 ATGAGGTTATTGAAACATGATGG + Intergenic
927294891 2:21442703-21442725 ATTCTGTCATTGCAACAACATGG + Intergenic
927695014 2:25233915-25233937 TTGCTGTGACTGAAACAAGAAGG - Exonic
929085119 2:38160278-38160300 GTGCTTTGATTAAAACAATAGGG - Intergenic
930492143 2:52088530-52088552 TTACTGTTATTGACACAATTAGG - Intergenic
934850096 2:97693399-97693421 TAGCTGCTATGGAAACAATATGG - Intergenic
936814934 2:116448613-116448635 ATGCTGTTAATGAAATTATATGG + Intergenic
937676075 2:124592164-124592186 ATGGTGTTTTTAAAAAAATATGG + Intronic
938147283 2:128847033-128847055 ATGCAGTTATGAAAACAAAAAGG - Intergenic
940256140 2:151731610-151731632 ATGCTGTAATGGGAACAAAATGG + Intronic
940623039 2:156137996-156138018 ATGCTGTTAGTGTTTCAATATGG + Intergenic
941379218 2:164771350-164771372 ATGTTGTTGTTTAAACAACAGGG + Intronic
941528665 2:166637448-166637470 ATGCAGTTATTTAAAAAATGGGG + Intergenic
941624625 2:167817874-167817896 ATCCTGTTATTTAAACAAACAGG + Intergenic
945493738 2:210484909-210484931 AAACTGTTACTGAAACACTAGGG - Intronic
945973008 2:216248499-216248521 ATCCTGTCATTGCAACAACATGG - Intergenic
946318701 2:218935083-218935105 CTGCTATAATTAAAACAATATGG - Intergenic
947237568 2:227958753-227958775 GTGTTGTTAATGAAACAATTAGG - Intergenic
948734541 2:239993105-239993127 ATGCTATAATTGATACACTATGG + Intronic
948820418 2:240540766-240540788 AATCTGTTATTGAAACATCACGG - Intronic
1170488714 20:16847735-16847757 ATGCTGTTTTTAAAAAAAAATGG - Intergenic
1170580420 20:17695152-17695174 ATTCTGTTATTTAAAAAGTAAGG + Intronic
1171296800 20:24024133-24024155 ATGCAGTGATTGAAGAAATATGG + Intergenic
1173156276 20:40613052-40613074 CTACTGTAGTTGAAACAATATGG - Intergenic
1173859638 20:46274426-46274448 ATGATATTAATGAAACAATTGGG + Intronic
1173992777 20:47315995-47316017 TTGCTGAAATTGTAACAATATGG + Intronic
1176013710 20:62916192-62916214 AAGTTGTTACTGATACAATATGG - Intronic
1177241291 21:18461435-18461457 AAGTTGTTACTGAAACACTAGGG - Intronic
1177832762 21:26157794-26157816 CTGGTGTTATTGAAACAGAATGG - Intronic
1177843739 21:26263955-26263977 ATTCTGCTATTGAAACCATCTGG - Intergenic
1178500446 21:33121795-33121817 AGGCAGTTATTTAAACAAGACGG + Intergenic
1181657022 22:24310500-24310522 ATGCTCTTTTGGAAAGAATATGG - Intronic
1182510019 22:30812464-30812486 ATGCTGTTCTTTAAAAAATGAGG - Intronic
950385245 3:12653799-12653821 ATGCTGTTATTCAAAGTTTATGG - Intronic
950914928 3:16634954-16634976 AGTCTGTTATGGAAACAAGAGGG + Intronic
951079460 3:18435168-18435190 ATTCTGTTATTGTTATAATAAGG + Intronic
951402704 3:22253307-22253329 AGACTGTAATTGAAACCATAAGG + Intronic
951436255 3:22668473-22668495 ATGCTGTTATAAAAACTAAAAGG - Intergenic
952047021 3:29334751-29334773 CTGCTGTTGCTGAGACAATATGG + Intronic
952564987 3:34645061-34645083 ATGGTGTTGTTCGAACAATAGGG + Intergenic
953927609 3:46990308-46990330 GTGCTGTTATTAAAACAAACTGG + Intronic
955298946 3:57758600-57758622 ATGCTATAATTGACAGAATAGGG - Intronic
956245958 3:67183447-67183469 ATGCTGTCATTGTAACATGAAGG + Intergenic
956291430 3:67664143-67664165 ATGCTGTGCTAGAAATAATATGG - Intergenic
957515767 3:81249075-81249097 ATGCTCTTATTGTAACAGTGAGG + Intergenic
958869984 3:99546846-99546868 AAACTCTTATTAAAACAATATGG - Intergenic
958898425 3:99856658-99856680 GTGATGTTTTTGAAAAAATAAGG - Intronic
960397886 3:117159485-117159507 ATGCTATTATTGGCATAATATGG + Intergenic
961710231 3:128822911-128822933 ATGCTGGAATTGACACAAGATGG + Intergenic
961799770 3:129438603-129438625 ATACTGTTATTGAAAAAAGCTGG + Intronic
963092198 3:141494005-141494027 ATGCAGTTGTTTAAAAAATAAGG - Intronic
963308676 3:143683410-143683432 ATGCTATTATTGAGAAAATTGGG - Intronic
964217540 3:154303328-154303350 AAGATGTAATTGAAAAAATAAGG - Exonic
964936228 3:162091608-162091630 ATGCTGTTATGGTTACTATAGGG + Intergenic
965351291 3:167614392-167614414 ATGCAGATATTGAAAGAATGAGG - Intronic
967415709 3:189215913-189215935 AGGCAGTTATTGAAGCAATAAGG - Intronic
971094451 4:23384728-23384750 ATACTGTCATTGAGAAAATATGG + Intergenic
971652797 4:29301178-29301200 CTGATGTTAATGAAAGAATAAGG + Intergenic
971680242 4:29690084-29690106 TTGTTATTATTGAAATAATATGG - Intergenic
971796939 4:31240136-31240158 ATGCTGACACAGAAACAATAAGG + Intergenic
974713985 4:65641791-65641813 GTTCTGTTTTTTAAACAATAAGG - Intronic
974738452 4:65972645-65972667 AAGCTGTTATTTACAAAATATGG - Intergenic
975375564 4:73640181-73640203 ATCCTGTCATTGCAATAATATGG - Intergenic
976071953 4:81251548-81251570 ATCCTGTCATTGCAACAATGTGG - Intergenic
977404951 4:96585670-96585692 ATGATGGCATAGAAACAATAGGG - Intergenic
977551677 4:98449555-98449577 ATGCTGTCGTTGAAACATTTAGG - Intergenic
979234068 4:118379422-118379444 ATGCTATTATTTAGACAATTGGG + Intergenic
979456533 4:120931586-120931608 TTGCACTTATTGAAACAAAATGG + Intergenic
979631808 4:122910852-122910874 ATGATGTTAATGAGACAAAACGG - Intronic
980247681 4:130268049-130268071 ATGCTGTTCTTGTAATAGTAAGG + Intergenic
980981957 4:139662272-139662294 ATTCTGTTATAGCAACAAAATGG - Intergenic
982486135 4:155968050-155968072 ATGCTGTTCTTGTAACAGTGAGG + Intergenic
983310488 4:166054391-166054413 ATGATTTTATTGAAAGACTATGG + Intronic
985828604 5:2211902-2211924 ATGTTGTTATTGAAATAATGCGG + Intergenic
986197377 5:5550481-5550503 ATGCTGCCATTGTAACAAGAAGG + Intergenic
986308709 5:6534976-6534998 ATGTAGTAATAGAAACAATATGG - Intergenic
987224834 5:15829815-15829837 ATTTTGTTATTAAAATAATAAGG + Intronic
987727479 5:21720834-21720856 ATGCTATAATTGAAATAATTTGG + Intergenic
987914798 5:24198790-24198812 ATTGTGTTATTTCAACAATATGG - Intergenic
988654055 5:33188237-33188259 AAGCTGTTATTCAAACATGAAGG - Intergenic
989560007 5:42839554-42839576 ATTCTGTTTGTGAAACTATAAGG - Intronic
993814299 5:92522297-92522319 TTCCTGTTATTGACACAGTATGG + Intergenic
994497564 5:100533313-100533335 ATGATGTTTTACAAACAATATGG - Intergenic
997000138 5:129749622-129749644 ATTCTGTGATATAAACAATAAGG - Intronic
997302601 5:132816895-132816917 ATTCTGTTATTGAAAGAAGTTGG + Intergenic
997794192 5:136791755-136791777 AAGCTTTTATTGAAACAATGAGG + Intergenic
998761547 5:145437810-145437832 ATGCTGCTATTAAAGAAATATGG + Intergenic
998944945 5:147328681-147328703 TTGCTTTTATTTAAAAAATAAGG + Intronic
999003624 5:147951667-147951689 ATGCTGTTATTGTGACAACAAGG - Intergenic
1000832149 5:166116178-166116200 ATGCTGTCATTAAAAAAATGAGG - Intergenic
1002840570 6:901676-901698 ATGCAGGTAATGAAACAAAAGGG - Intergenic
1005083033 6:21976497-21976519 CTGCTGTTACTGTTACAATATGG + Intergenic
1007513971 6:42396541-42396563 ATACTTTTATTGTAACAGTATGG + Intronic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008563280 6:52743039-52743061 TTGCTGGTATTGAATCAATCTGG + Intergenic
1008564525 6:52754366-52754388 TTGCTGGTATTGAATCAATCTGG + Intronic
1008568840 6:52795608-52795630 TTGCTGGTATTGAATCAATCTGG + Intronic
1008822840 6:55654366-55654388 TTTCTGTTATTGACTCAATAAGG + Intergenic
1009050671 6:58272142-58272164 ATGCTGTTATTGAACTAAGTTGG - Intergenic
1009239752 6:61170246-61170268 ATGCTGTTATTGAACTAAGTTGG + Intergenic
1010795855 6:80115548-80115570 ATGATGTCAATGAAACAATCTGG - Intronic
1011420461 6:87166400-87166422 ATGCTTTCTTTGAAAAAATAAGG + Intronic
1012265751 6:97140017-97140039 ATGTTGTTACTGAAATTATAAGG + Exonic
1012743764 6:103055606-103055628 CAGCTGTTATATAAACAATAAGG + Intergenic
1014033823 6:116741878-116741900 ATGCTTTTTATGAAACAATCAGG + Intergenic
1014253276 6:119136911-119136933 ATGCTGTTACTAAAAAAATGGGG + Intronic
1014699428 6:124665269-124665291 CTGCAGTAATTGAAACAGTATGG + Intronic
1015480075 6:133699045-133699067 ATACTGTTACCGAAACATTAGGG - Intergenic
1016746942 6:147591115-147591137 ATGCTCTTATGGAAACAATATGG - Intronic
1016872636 6:148834018-148834040 ATGCTGTTATTGAAACAATATGG + Intronic
1017695889 6:157015809-157015831 ATGCTGTGATTGGCACAATGAGG - Intronic
1018446729 6:163865187-163865209 CTGCTGTTATTTAAACAAAATGG - Intergenic
1020491588 7:8791643-8791665 ATTCTGTTATAGCAACAAAATGG - Intergenic
1020670548 7:11103296-11103318 AAGCTTATATTAAAACAATAAGG - Exonic
1020963812 7:14840785-14840807 ATGCTGTGCTTGAGACAGTATGG - Intronic
1021405195 7:20259104-20259126 CTGCTCATATTGAAACAACATGG - Intergenic
1024409041 7:49017433-49017455 ATGATGTTATTGATATATTATGG - Intergenic
1030504582 7:110404507-110404529 ATCCTGCCATTGAAACAACATGG + Intergenic
1030971583 7:116063751-116063773 ATCCTGTTATTGTAAAAACATGG - Intronic
1031426564 7:121612598-121612620 ATGCTGTTTTAGAAACATTTTGG + Intergenic
1031824049 7:126540930-126540952 AAGCTGTTATTTAAAAAATGTGG + Intronic
1032308882 7:130763602-130763624 ATGCCATTATGGAAACAGTATGG - Intergenic
1033265551 7:139883430-139883452 ATGCTGTTATAGAAAGAGGATGG - Intronic
1033718050 7:144023619-144023641 ATGTTGTCATGGTAACAATAGGG + Intergenic
1035721072 8:1792464-1792486 ATGCTGAAATTGTAACAAGAAGG - Intergenic
1036250374 8:7157326-7157348 ATGCTGTAATTAAACCTATAGGG - Intergenic
1036441264 8:8782894-8782916 TTGCCTTTATTTAAACAATATGG + Intergenic
1037539780 8:19859809-19859831 ATGGTGTGATGGAAAAAATAGGG - Intergenic
1038108731 8:24468647-24468669 ATGTTGATATTGATACAAAATGG - Intronic
1038231760 8:25706969-25706991 CTCCTGTTATTGAAACACCAGGG - Intergenic
1038641218 8:29330444-29330466 AGTCTCTTAGTGAAACAATATGG + Intergenic
1040430439 8:47336304-47336326 ATACTGTTACTGAAACACCAGGG + Intronic
1040682957 8:49835920-49835942 ATCTTGTTATTGAAACACCAGGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041124006 8:54616379-54616401 ATGCTGATATTGAAATAGAATGG + Intronic
1041565513 8:59273451-59273473 ATGCTGTAGTTGAAACCATTAGG + Intergenic
1041576490 8:59402169-59402191 ATGCTTATATTAAAAAAATAAGG + Intergenic
1041734971 8:61100536-61100558 AAGCTGTTTTTGAAAAAAGAAGG - Intronic
1042202738 8:66296790-66296812 ATGCAATTATTGATACATTATGG + Intergenic
1042971133 8:74410022-74410044 ATACTGTTACTGAAACACCAGGG - Intronic
1043172449 8:76982280-76982302 ATAGTTTTATTGAAACAAAAGGG - Exonic
1044396786 8:91722125-91722147 ATGATGTTATAGAAATAATTGGG - Intergenic
1045910189 8:107398375-107398397 ATGCTTTTCTTGAAATAATAGGG - Intronic
1046721693 8:117627336-117627358 TAGCTGTGATAGAAACAATATGG - Intergenic
1048529224 8:135232593-135232615 ATGGTGTTATGGAAGCAACAAGG + Intergenic
1048769310 8:137878707-137878729 ACGATGTTTTTGAAACCATATGG - Intergenic
1049080179 8:140436763-140436785 ATTCTCTAATTGATACAATAAGG + Intronic
1049484182 8:142843313-142843335 ATTCTGTTATTGAATCCACAAGG - Intronic
1050703460 9:8367378-8367400 ATGTTTTTATTGTAACAATGTGG + Intronic
1052184159 9:25570228-25570250 ATGATGGTATTGTAACCATATGG + Intergenic
1053132173 9:35622035-35622057 ATGATGTAATAGAAAGAATAGGG + Intronic
1053918249 9:42961540-42961562 ATCCTGTTCTAGGAACAATAAGG + Intergenic
1055625270 9:78170171-78170193 ATGCAGTTATTAAAAGAATGAGG - Intergenic
1056409982 9:86315884-86315906 CTCCTGTTATTTAAACAACATGG + Intronic
1056987846 9:91380677-91380699 ATGCTGTTATTCAAAAAAGAAGG + Intergenic
1059049598 9:110909449-110909471 ATACTGTTACTGAAACACCAGGG - Intronic
1060309635 9:122447778-122447800 ATCCTGTTCTAAAAACAATAGGG + Intergenic
1060354874 9:122896298-122896320 ATAGTGTAAATGAAACAATAAGG - Intronic
1061813807 9:133180823-133180845 ATGCTGTTTGTGAAACATTCTGG - Intergenic
1186903862 X:14089805-14089827 TTGCTGTCATTGGAACATTAAGG + Intergenic
1187236401 X:17471628-17471650 CTGCTGTAATTGAAACCATAGGG + Intronic
1188328874 X:28843955-28843977 AAGAGGCTATTGAAACAATAAGG - Intronic
1189060761 X:37751179-37751201 ATCCTGTCATTGAAACAACATGG - Intronic
1189060913 X:37752859-37752881 ATCCTGTCATTGAAACAACAGGG + Intronic
1190336455 X:49265640-49265662 ATGATGTTCCTGAAACAAGAGGG - Intergenic
1190853797 X:54273204-54273226 ATTCTGTGACTGAATCAATATGG + Intronic
1192586699 X:72324854-72324876 AAGATGTTATTAAAACAATGAGG - Intergenic
1192872519 X:75198177-75198199 TTACTGATATTTAAACAATATGG + Intergenic
1193112708 X:77745422-77745444 ATCCTGTCATTGCAACAACATGG + Intronic
1193437211 X:81489957-81489979 ATAGTGTTATTGATACAAAAAGG - Intergenic
1194422397 X:93692692-93692714 GTGCTGCTATTGAACCATTATGG + Intronic
1197304744 X:124827739-124827761 ATGCTCTTCTTGGAATAATAAGG - Intronic
1197346769 X:125333794-125333816 ATGCTGTTCTTGTGACAGTAAGG - Intergenic
1197441828 X:126500813-126500835 ATTTTGTAATTGAAAAAATATGG - Intergenic
1198413924 X:136400673-136400695 TTCCTGTTCTTTAAACAATATGG - Intronic
1198944387 X:141994526-141994548 AAACTGTCAGTGAAACAATAAGG - Intergenic
1199083267 X:143600688-143600710 CTGCTGTAATCAAAACAATATGG + Intergenic
1200448532 Y:3295524-3295546 GTGCTGTGTTTGAAACATTAAGG + Intergenic
1201411318 Y:13702315-13702337 ATTATGCTAATGAAACAATATGG + Intergenic