ID: 1016873636

View in Genome Browser
Species Human (GRCh38)
Location 6:148842888-148842910
Sequence GACATACTCTGTGTGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016873630_1016873636 26 Left 1016873630 6:148842839-148842861 CCTAGTGAGTAGTACTTAGTGGG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1016873636 6:148842888-148842910 GACATACTCTGTGTGGTTCTGGG 0: 1
1: 0
2: 3
3: 11
4: 142
1016873633_1016873636 -5 Left 1016873633 6:148842870-148842892 CCACTCTGTCGCGGTGATGACAT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1016873636 6:148842888-148842910 GACATACTCTGTGTGGTTCTGGG 0: 1
1: 0
2: 3
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016873636 Original CRISPR GACATACTCTGTGTGGTTCT GGG Intronic
901121003 1:6893663-6893685 GAGAGACTAGGTGTGGTTCTTGG + Intronic
901267744 1:7924802-7924824 CACCAACTCTGTGTGGGTCTAGG + Intronic
902127557 1:14228927-14228949 AACATACTGAGTATGGTTCTGGG - Intergenic
902314320 1:15606417-15606439 GAAGTACTCTGTGTTGTACTAGG - Intergenic
903282735 1:22259219-22259241 CAGAGGCTCTGTGTGGTTCTTGG + Intergenic
904282595 1:29431634-29431656 CACTTACGCTGTGTGGTTTTTGG + Intergenic
905905752 1:41617397-41617419 GAGATGTTCTGTGTGGTCCTCGG - Intronic
907807272 1:57833506-57833528 GGCATAAGCTGTGTGGTCCTGGG - Intronic
907964122 1:59312751-59312773 GACATTACCTGTGTGGCTCTTGG + Intronic
907984620 1:59518228-59518250 AACAAACTATGTGTTGTTCTAGG - Intronic
913138046 1:115911781-115911803 CACATAATCTTTGTGGCTCTTGG + Intergenic
913230438 1:116736565-116736587 CATATACTCTGTTTGTTTCTCGG - Intergenic
917736185 1:177922505-177922527 CACTTTCTATGTGTGGTTCTGGG + Intergenic
918843925 1:189583980-189584002 CACATAGTCTGTTTTGTTCTTGG + Intergenic
921534912 1:216335689-216335711 TACATAGTTTGTGTGTTTCTTGG - Intronic
923308100 1:232707039-232707061 TAGATACTCTGTGGGGTGCTAGG - Intergenic
1069605854 10:69738147-69738169 GACACTCACTGTGTGGTTTTGGG + Intergenic
1075160414 10:120019648-120019670 GATATCCTCAGTTTGGTTCTGGG + Intergenic
1075845305 10:125540474-125540496 GTCATGCTGTGTGTGGCTCTGGG + Intergenic
1077154741 11:1086241-1086263 GACACACTCTGTGTGGTACTGGG - Intergenic
1077774425 11:5255320-5255342 AATATACTCTCTGTGGTTTTAGG + Intronic
1077931611 11:6738721-6738743 GACAAACATTGTGTGGCTCTAGG + Intergenic
1078222367 11:9362581-9362603 CACACACTCTGTGGGATTCTCGG - Intergenic
1080277402 11:30518124-30518146 CAGAGACTGTGTGTGGTTCTTGG - Intronic
1085023853 11:73225283-73225305 GCCTTTCTCTTTGTGGTTCTAGG - Intronic
1088001216 11:104883343-104883365 CACATACTGTGTGTGTTTCCAGG - Intergenic
1088775872 11:113082236-113082258 GGAACAATCTGTGTGGTTCTTGG - Intronic
1091034351 11:132219757-132219779 CACATACTATGTGTTGTTATGGG - Intronic
1092387007 12:8043590-8043612 GGCATACTCAGTGAGTTTCTAGG + Intronic
1094253523 12:28394970-28394992 GACATATTCTGGGTGTTTATTGG + Intronic
1097682020 12:62657936-62657958 GACATACTCTGTAGGGTTTATGG + Intronic
1100132783 12:91517118-91517140 GTCCTTCTCTGTGTGGTGCTGGG + Intergenic
1101833688 12:108279823-108279845 GGTAGATTCTGTGTGGTTCTGGG + Intergenic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1106075745 13:26459490-26459512 GATATACCCTGTGTGGGGCTAGG + Intergenic
1106606802 13:31235969-31235991 GACAGACTCTGTGTTGTTGCAGG + Intronic
1107439361 13:40410894-40410916 GAGACAATCTGTGTTGTTCTGGG - Intergenic
1110328981 13:74249753-74249775 GAAATGCTCTGTGGGGTCCTTGG + Intergenic
1110893717 13:80722673-80722695 GAAATATTCTATGTGGGTCTCGG + Intergenic
1113431752 13:110256495-110256517 GACATCCTCCCTGTGGTTCTGGG - Intronic
1116363212 14:44027838-44027860 AACTTACTTTGTGTGGTTCCAGG - Intergenic
1117505629 14:56399941-56399963 GCCATTCTCTCTGTGGTTTTAGG - Intergenic
1117641571 14:57805226-57805248 CACATACTATTTCTGGTTCTAGG - Intronic
1117862136 14:60103587-60103609 TACATTCTCTTTGTGCTTCTTGG + Intronic
1119712546 14:76832859-76832881 GACAGAGTCTATGTGGTTCTGGG + Intronic
1120603446 14:86541564-86541586 GACACAATCTTTGTGTTTCTGGG - Intergenic
1120629918 14:86878042-86878064 GACATACTGTATGTAGTTTTGGG - Intergenic
1121812530 14:96903963-96903985 GTGATGCCCTGTGTGGTTCTGGG + Intronic
1121951457 14:98174333-98174355 GTGAAACTGTGTGTGGTTCTTGG + Intergenic
1122615040 14:103011309-103011331 GACACACGCGGTGTGGCTCTGGG - Intronic
1126477657 15:49082641-49082663 GACATACTCCATGTGGCTATGGG + Intergenic
1126560452 15:50037353-50037375 GACAGAGTATGTGTGGTTGTGGG - Intronic
1126917632 15:53483650-53483672 GACAGAGTCTGTGAGGCTCTGGG - Intergenic
1128113155 15:65088967-65088989 GACAGAATATGTGTGTTTCTGGG + Intergenic
1128635800 15:69301607-69301629 AACAGACCCTGTGTGGTTTTAGG + Intronic
1129328330 15:74813576-74813598 GACACACTCTTTGTAGGTCTGGG - Intronic
1129612538 15:77071895-77071917 CACTTACTATGTGTGGCTCTGGG - Intronic
1131708493 15:95025100-95025122 GAGATACTTTCTGTGGTACTGGG + Intergenic
1133670535 16:8014791-8014813 CACATATACTGTGTAGTTCTGGG - Intergenic
1134331424 16:13254665-13254687 GAAAGACTCTATTTGGTTCTGGG - Intergenic
1137518269 16:49169457-49169479 GAAATATTATGTGTAGTTCTGGG + Intergenic
1139494191 16:67304104-67304126 GACATTCTGTGTGTGGTGGTTGG + Intronic
1140397863 16:74644470-74644492 GACATAATTAGAGTGGTTCTAGG + Intronic
1140493365 16:75360682-75360704 GACTTATTCTGTGTGGTTTGGGG - Intronic
1141543411 16:84745116-84745138 GACAGAGTCTGTGGAGTTCTGGG - Exonic
1141747978 16:85938793-85938815 GCCATTCTCTGTGGGGTGCTGGG - Intergenic
1142499313 17:323535-323557 GACACACTTCGTGTGGTTCCCGG + Intronic
1146432681 17:32812655-32812677 GATATAGCCTGTGGGGTTCTGGG + Intronic
1147654704 17:42082240-42082262 GTCATACCCTGTGAGGTGCTGGG - Intergenic
1147900883 17:43783328-43783350 GACAAACTCTGTGTGTGTCTGGG - Intronic
1149076213 17:52598144-52598166 TACATACTCTGGGTGGGTGTAGG + Intergenic
1150866930 17:68861187-68861209 ACCATGCTCTGTGTGGTTCTAGG + Intergenic
1152354001 17:79797984-79798006 GACATCCTCTGTGGGGTCCTGGG - Intronic
1162890567 19:13729907-13729929 GACAAACTTTGTGTGGTTATGGG - Intergenic
926276768 2:11409523-11409545 GGCATTCTGTGTGTGTTTCTGGG + Intergenic
929937356 2:46303275-46303297 CACCTACTCTGTGTGGTTCCGGG - Intronic
930432796 2:51302013-51302035 GACTTACTAAATGTGGTTCTAGG + Intergenic
931884300 2:66599187-66599209 GAAGTGCTCTGTGGGGTTCTGGG + Intergenic
932689276 2:73898661-73898683 GGGGTACTGTGTGTGGTTCTTGG - Intronic
932951273 2:76296751-76296773 GACATTCACTGTGTGGTCCATGG - Intergenic
932968163 2:76502872-76502894 GAAATACTCATAGTGGTTCTTGG + Intergenic
935626341 2:105175121-105175143 CACCTACTCTGTGTGGGGCTTGG - Intergenic
942846879 2:180437519-180437541 CACATCCTCTATGGGGTTCTAGG + Intergenic
944787292 2:203086317-203086339 GGCATTCCCTGTTTGGTTCTAGG + Intronic
947592205 2:231392276-231392298 AACTTTCTCTGAGTGGTTCTGGG - Intergenic
1168816891 20:743812-743834 GAGATAATCTGTATGGTTTTTGG + Intergenic
1168971961 20:1937393-1937415 GGCATACTCCGTGTGGTTGTTGG - Exonic
1170042277 20:12051458-12051480 GACATAACCTGTGTGATTATTGG + Intergenic
1170352104 20:15453022-15453044 GACACACTCAGTTTAGTTCTGGG - Intronic
1173591948 20:44231658-44231680 GACTTGTTCTGTGAGGTTCTGGG - Intergenic
1178717902 21:34983643-34983665 GGCAGACTGTGTGTAGTTCTAGG - Intronic
1179174042 21:38994348-38994370 GACATATTCTGGATGGCTCTGGG + Intergenic
1182470223 22:30543908-30543930 GGCATACTCTGTGTGGTTGTTGG - Intronic
1182555882 22:31128077-31128099 GACATGCTCTGTGTGCTTCTGGG - Intronic
952209632 3:31216522-31216544 GAGATACTCTCTGAGGTCCTAGG - Intergenic
954557656 3:51530912-51530934 GAAATACTATGGGTGGTTTTGGG + Intergenic
956698580 3:71939369-71939391 TACATATTCTGTCTGGTTCCTGG + Intergenic
970826196 4:20279196-20279218 GAAATACTCTGTATTGTACTTGG + Intronic
974856095 4:67463107-67463129 GATATTCTCTGTTTTGTTCTTGG - Intergenic
975763711 4:77643789-77643811 TACATATTCTGTGTTTTTCTGGG - Intergenic
976069035 4:81220527-81220549 GACCTGCTGTGTGTGGTACTGGG - Intergenic
977363131 4:96032144-96032166 GACACACTATGTGTGTCTCTGGG - Intergenic
983524263 4:168744424-168744446 GACTTACTCTCTGTGTCTCTAGG + Intronic
986155916 5:5175836-5175858 GACAGAATCTGTGTGATTGTGGG - Intronic
986295242 5:6432133-6432155 GACATTCTGTGTGTGTGTCTTGG + Intergenic
986949403 5:13063780-13063802 GATGTACTCTGTGTGCCTCTTGG - Intergenic
993527709 5:88986838-88986860 GACAAACTCTGTGTGGTATTAGG - Intergenic
999391048 5:151190954-151190976 GACATACTCTGTGTTTTATTTGG - Intronic
999525209 5:152397737-152397759 CATACACTCTGTGTGGTGCTTGG - Intronic
999830062 5:155310201-155310223 GACTTGCTCTGTGTAGTTCTAGG + Intergenic
1001763279 5:174224976-174224998 GAGAAACTCTGAGTGGTTGTGGG - Intronic
1007476843 6:42124702-42124724 GACAAGCTCTGTGTGGGTGTGGG - Intronic
1007594756 6:43044656-43044678 GACATAATCCAGGTGGTTCTAGG + Intronic
1007800595 6:44388855-44388877 CACATCCTCTGTGTGGTACTCGG + Intronic
1007811516 6:44489725-44489747 GACATTCTCTTTCTTGTTCTGGG - Intergenic
1009055176 6:58326594-58326616 GCCATATTCTATGTGGCTCTGGG - Intergenic
1009235986 6:61123981-61124003 GCCATATTCTATGTGGCTCTGGG + Intergenic
1012403137 6:98861443-98861465 GACCTACCCTGTATGTTTCTGGG + Intergenic
1013842332 6:114412301-114412323 GAAACATTCTGTGTGGTCCTGGG + Intergenic
1015122937 6:129720926-129720948 ATCATACTCTGTGATGTTCTGGG + Intergenic
1016873636 6:148842888-148842910 GACATACTCTGTGTGGTTCTGGG + Intronic
1017102104 6:150857951-150857973 GAAATCCAATGTGTGGTTCTGGG - Intergenic
1020077652 7:5269083-5269105 GACATACTCAGGGTGTTTTTCGG - Intergenic
1020886849 7:13828942-13828964 GACTTACTCTGTCTCCTTCTTGG + Intergenic
1021790570 7:24200794-24200816 GACATGCTCAGTGTGGAGCTGGG - Intergenic
1021903738 7:25313202-25313224 GATGTATCCTGTGTGGTTCTCGG + Intergenic
1024174803 7:46827984-46828006 GACTGACTCTGTGAGGGTCTTGG - Intergenic
1025037878 7:55609873-55609895 AACTTACTCTGTATGGCTCTGGG - Intergenic
1026290625 7:69002681-69002703 GACAGGGTCTGTGTGATTCTGGG + Intergenic
1027778810 7:82498528-82498550 AACATACTCTTGGTGGATCTTGG + Intergenic
1028695192 7:93701610-93701632 GACTTATTCTCTGTGGATCTTGG + Intronic
1029638187 7:101799658-101799680 GACATAATGTGTGTGCATCTGGG + Intergenic
1029894924 7:103973254-103973276 GAGAGTGTCTGTGTGGTTCTAGG + Intronic
1030609906 7:111678138-111678160 GACATTCTCAGTGTGGTTTAAGG + Intergenic
1031155585 7:118107025-118107047 AACAAAGTCAGTGTGGTTCTTGG + Intergenic
1034156156 7:148957642-148957664 GACATCTTGTGTGTGGTTTTAGG - Intergenic
1034925711 7:155119805-155119827 GACAGAGTCTATGTGATTCTGGG - Intergenic
1037333827 8:17772655-17772677 AACATACTTTGTCTGGTTTTGGG - Intronic
1040830616 8:51672585-51672607 GTCATACTCTAAGTGGTTGTTGG + Intronic
1040936940 8:52791256-52791278 GACAGGGTCTGTGTGATTCTAGG + Intergenic
1041198575 8:55426586-55426608 GAACTACTCTGCTTGGTTCTGGG - Intronic
1044024705 8:87154540-87154562 GAGACACTCTGTGTACTTCTTGG + Intronic
1048653096 8:136502905-136502927 ACCATACTCTGTGTGGTGCACGG - Intergenic
1048755619 8:137734542-137734564 GAAAAACACTGTGTGTTTCTGGG - Intergenic
1049639646 8:143709152-143709174 GACAGGGTCTGTGTGATTCTGGG - Intronic
1060327537 9:122631810-122631832 CACATACCCTGTGTGGGTGTAGG - Intergenic
1061234135 9:129332596-129332618 GACATGCTCTGTGGGCATCTTGG + Intergenic
1185652601 X:1659960-1659982 GACACTCTCTGTGTGGTCCCAGG + Intergenic
1185852287 X:3500429-3500451 AAACTACTCTGTGTGGTACTAGG + Intergenic
1189886590 X:45552237-45552259 CACCTACTTTGTGTGGTTATTGG + Intergenic
1190600736 X:52089532-52089554 TAGATACTCTGTCTGGCTCTGGG - Intergenic
1193899519 X:87160763-87160785 GACAGACTCTGTTTGTTTGTGGG - Intergenic
1194406868 X:93507172-93507194 TACTTACTCTGTGTGACTCTGGG - Intergenic
1194567333 X:95507174-95507196 CACAAACTCTGTCTTGTTCTTGG - Intergenic
1194701469 X:97119605-97119627 GACATACTCTTGGGAGTTCTAGG - Intronic
1195196280 X:102500454-102500476 GACAAACACTGTCTGCTTCTTGG - Intergenic
1201533593 Y:15020370-15020392 GACAGGGTCTGTGTGTTTCTGGG + Intergenic