ID: 1016885346

View in Genome Browser
Species Human (GRCh38)
Location 6:148954744-148954766
Sequence AGCCTCACGTGTTTGATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016885341_1016885346 23 Left 1016885341 6:148954698-148954720 CCCCTGACATTAAGCAATGCGTG 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1016885346 6:148954744-148954766 AGCCTCACGTGTTTGATGCTGGG No data
1016885343_1016885346 21 Left 1016885343 6:148954700-148954722 CCTGACATTAAGCAATGCGTGAC No data
Right 1016885346 6:148954744-148954766 AGCCTCACGTGTTTGATGCTGGG No data
1016885342_1016885346 22 Left 1016885342 6:148954699-148954721 CCCTGACATTAAGCAATGCGTGA No data
Right 1016885346 6:148954744-148954766 AGCCTCACGTGTTTGATGCTGGG No data
1016885344_1016885346 -8 Left 1016885344 6:148954729-148954751 CCATTTGATTTTCTAAGCCTCAC 0: 1
1: 0
2: 1
3: 25
4: 291
Right 1016885346 6:148954744-148954766 AGCCTCACGTGTTTGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016885346 Original CRISPR AGCCTCACGTGTTTGATGCT GGG Intronic