ID: 1016887191

View in Genome Browser
Species Human (GRCh38)
Location 6:148969662-148969684
Sequence CTCCAGGTCTGGAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 304}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016887191_1016887200 19 Left 1016887191 6:148969662-148969684 CCATTTTTCCTCCAGACCTGGAG 0: 1
1: 0
2: 0
3: 32
4: 304
Right 1016887200 6:148969704-148969726 CATAGAGGCTGCTGTTTTCCTGG No data
1016887191_1016887203 27 Left 1016887191 6:148969662-148969684 CCATTTTTCCTCCAGACCTGGAG 0: 1
1: 0
2: 0
3: 32
4: 304
Right 1016887203 6:148969712-148969734 CTGCTGTTTTCCTGGGGCTCAGG 0: 1
1: 1
2: 3
3: 41
4: 449
1016887191_1016887195 -8 Left 1016887191 6:148969662-148969684 CCATTTTTCCTCCAGACCTGGAG 0: 1
1: 0
2: 0
3: 32
4: 304
Right 1016887195 6:148969677-148969699 ACCTGGAGCTCCTCTGCTCAGGG No data
1016887191_1016887194 -9 Left 1016887191 6:148969662-148969684 CCATTTTTCCTCCAGACCTGGAG 0: 1
1: 0
2: 0
3: 32
4: 304
Right 1016887194 6:148969676-148969698 GACCTGGAGCTCCTCTGCTCAGG 0: 1
1: 0
2: 2
3: 30
4: 394
1016887191_1016887202 21 Left 1016887191 6:148969662-148969684 CCATTTTTCCTCCAGACCTGGAG 0: 1
1: 0
2: 0
3: 32
4: 304
Right 1016887202 6:148969706-148969728 TAGAGGCTGCTGTTTTCCTGGGG No data
1016887191_1016887198 4 Left 1016887191 6:148969662-148969684 CCATTTTTCCTCCAGACCTGGAG 0: 1
1: 0
2: 0
3: 32
4: 304
Right 1016887198 6:148969689-148969711 TCTGCTCAGGGAGTCCATAGAGG 0: 1
1: 0
2: 2
3: 13
4: 131
1016887191_1016887201 20 Left 1016887191 6:148969662-148969684 CCATTTTTCCTCCAGACCTGGAG 0: 1
1: 0
2: 0
3: 32
4: 304
Right 1016887201 6:148969705-148969727 ATAGAGGCTGCTGTTTTCCTGGG 0: 1
1: 0
2: 0
3: 28
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016887191 Original CRISPR CTCCAGGTCTGGAGGAAAAA TGG (reversed) Intronic
900465316 1:2822440-2822462 CTCCAGGGCGTGAGGAAACAGGG + Intergenic
901110562 1:6790258-6790280 CTCCTGCTGAGGAGGAAAAAAGG - Intronic
902613715 1:17612257-17612279 AACCAGTTCTGCAGGAAAAAGGG - Intronic
903259943 1:22126213-22126235 CTCCTGGCCTGGAGGCAAGATGG - Intronic
903959011 1:27044910-27044932 CTCCAGTGCTGGAGGGAAAGGGG - Intergenic
905521380 1:38603150-38603172 CTGCACTTCTGGAGAAAAAAAGG + Intergenic
905908250 1:41634008-41634030 CTCCGAGCTTGGAGGAAAAAGGG + Intronic
906478513 1:46185657-46185679 CCCCAAGTCTGGAGCAGAAAGGG - Exonic
906771679 1:48490635-48490657 GTTCATGTCTGGAGGAAAAAGGG - Intergenic
907325227 1:53633589-53633611 CTCCATGTCTGGAAGAAATTAGG + Intronic
911190630 1:94945071-94945093 CTCCAGGCCTGCTGGAGAAACGG - Intergenic
912404905 1:109428978-109429000 ATCTAGGGCTGGAGGAAAAGGGG + Intergenic
914991381 1:152502224-152502246 ATGCAGGAGTGGAGGAAAAAGGG + Intergenic
915057396 1:153147191-153147213 CTGCAATTCTGGAGGAAAACAGG + Intergenic
915475576 1:156150890-156150912 CTCCAGGGCTTGTGGAGAAATGG + Intronic
915876324 1:159615219-159615241 AACCAGGTTTGTAGGAAAAAGGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917498229 1:175562222-175562244 CTTCAGTGCTGGAGAAAAAATGG - Intronic
921833273 1:219751737-219751759 CTCCAGGTTTGGAGAACAAATGG + Intronic
922133801 1:222805658-222805680 CTCTAGGGCTGGAGGAACAAAGG + Intergenic
922719339 1:227892372-227892394 TTCCAGGTCTGGACGAAAGGTGG + Intergenic
922787755 1:228291578-228291600 CTCCCGCTCTGGAGGAAACTAGG - Intronic
923185680 1:231570948-231570970 CTTCATGTATGGAGGTAAAATGG + Intronic
923459333 1:234195070-234195092 CTCAAGCTCTGGGAGAAAAAGGG + Intronic
1063341704 10:5271404-5271426 CTCCAGCTCCAGAGGGAAAAGGG + Intergenic
1064092584 10:12397389-12397411 AGCCAGGACTGGAAGAAAAAAGG - Intronic
1064312416 10:14223317-14223339 CTCCAGATATGGGGGAAGAAAGG - Intronic
1064770418 10:18717198-18717220 CCCTATATCTGGAGGAAAAAAGG - Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1066459509 10:35600962-35600984 CTCCAGGGCTGGTGGGAAAAGGG - Intergenic
1067070670 10:43128791-43128813 CTCCAGGGCTGGAGGGGAAGAGG + Exonic
1069878198 10:71576019-71576041 CTCCAGGACAGGAGGACAATGGG - Intronic
1070330106 10:75410277-75410299 CCCCAGATCTGAAGGAAAGAAGG - Intergenic
1070962163 10:80506921-80506943 TTCCAGGCCTGGAGGGAAACGGG - Intronic
1071246811 10:83773859-83773881 CTTCAGGTCTGGAGCATAAGAGG + Intergenic
1071497199 10:86176967-86176989 GACCAGATCTGGAGGAGAAATGG + Intronic
1072275135 10:93815540-93815562 CTCCAATTCTGGAGTCAAAAGGG - Intergenic
1072799970 10:98385889-98385911 GTCCAGGTATAGAGGAAAGAAGG - Intronic
1073016528 10:100404358-100404380 CTCCAGGCCTGAAGGAAACAGGG + Intergenic
1073063669 10:100746178-100746200 CTTCAGGACTTGAGGAGAAAAGG - Exonic
1073075587 10:100824170-100824192 CTCCAAGCCTGAAGGAAAGATGG + Intronic
1073268770 10:102244335-102244357 CTCCAGGTCTGCAGGGACACTGG + Intergenic
1074383558 10:112999596-112999618 CTCATGGTGTGGATGAAAAATGG + Intronic
1074394186 10:113083950-113083972 CTCCAAGTCTAGATGTAAAAGGG - Intronic
1077245021 11:1532566-1532588 CACCATGTCTGGAGGGGAAAAGG + Intergenic
1078886020 11:15500679-15500701 CTCCAGGTCTGCAGGCACAAGGG + Intergenic
1079335572 11:19567665-19567687 CTCCAGGGCTGGAGGTTAAAGGG - Intronic
1080268521 11:30425856-30425878 ATCCAGGTTTGAAAGAAAAAGGG + Intronic
1082755626 11:57073419-57073441 TTCAAGGTCTGGAGACAAAATGG - Intergenic
1083590450 11:63890585-63890607 CACCAGGTCTGGAGGAGAGCGGG + Intronic
1086110536 11:83193867-83193889 CACCACGTGTGGAGGATAAACGG + Intronic
1086316937 11:85605303-85605325 CTCCATTTCTGGAGGATTAAGGG - Intronic
1086425287 11:86676918-86676940 CTCCAGGGTTGGAGGAACAAAGG - Intergenic
1088599715 11:111463457-111463479 CTCCAGGGCTGGAGGATCAGAGG + Intergenic
1089257798 11:117203167-117203189 TTCCAGGTCTGGCTGAAGAATGG + Exonic
1089411509 11:118246954-118246976 CCCCAGGTCTGAAGGGCAAAGGG + Intronic
1089655256 11:119942436-119942458 CACCTGGACTGGAGGAATAAAGG - Intergenic
1091300570 11:134504657-134504679 CCCCAGGCCTGGAGGAGCAAGGG + Intergenic
1091891273 12:4056523-4056545 CTCCAGGGCTGGAGCGAACAAGG + Intergenic
1093136493 12:15458373-15458395 ACCCAAATCTGGAGGAAAAAAGG - Intronic
1095850990 12:46805986-46806008 CTCCAGGACTCCAGGAAATAAGG + Intronic
1096240610 12:49958024-49958046 CTCCAGGGGTGGAGGGAAATTGG + Exonic
1097284341 12:57865739-57865761 TTCCAGGATTGGAGTAAAAATGG - Intergenic
1098481147 12:70963109-70963131 CTCGAGGTCTGTAAGGAAAAGGG + Intergenic
1099163082 12:79269623-79269645 CTCCAGGTCTGGAAGACAACTGG - Intronic
1099991880 12:89731453-89731475 CTCTAGGTCTGTTGGAAAATGGG - Intergenic
1102033938 12:109760346-109760368 CTCCGGTTATGGAGGAAAGAGGG + Intronic
1102050099 12:109855966-109855988 CACCAGGCCTGGAGGAGAGAAGG - Intronic
1102216249 12:111163504-111163526 CTCCAGGAATGGAGGGACAATGG - Intronic
1102539551 12:113608814-113608836 CTCCCAGTATGGAGGAAAGAAGG + Intergenic
1103088536 12:118080856-118080878 GTCCAGGTCTGGGGAAAAGAGGG + Intronic
1103242296 12:119423664-119423686 CTCCAGGGCTGGAGGAATTAAGG - Intronic
1104660769 12:130610128-130610150 CTCCCGTTCTGGGGGAAAATGGG + Intronic
1104660784 12:130610171-130610193 CTCCCGTTCTGGGGGAAAATGGG + Intronic
1104660798 12:130610214-130610236 CTCCCGTTCTGGGGGAAAATGGG + Intronic
1104734070 12:131125397-131125419 CTCCAGGTCTGGGGAAGAGAAGG + Intronic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105662159 13:22508434-22508456 TTCAAGGACTGGAGGAAAAATGG - Intergenic
1106121512 13:26863456-26863478 CTACAGGTGTGGATGAGAAAGGG + Intergenic
1106244282 13:27933949-27933971 CTCCAGGGCTCCAGGGAAAAGGG - Intergenic
1107884973 13:44867640-44867662 CTTCAGGGCTGGAGAAGAAAAGG + Intergenic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1108911225 13:55553788-55553810 CTCCATGTGTAGTGGAAAAATGG - Intergenic
1111084511 13:83357247-83357269 CTGCAAGTCTGAAGGAACAAGGG - Intergenic
1112419847 13:99238412-99238434 CGCCTTGTCTGGAGGGAAAAAGG - Exonic
1112931527 13:104745268-104745290 CTCCACCTCTTTAGGAAAAATGG - Intergenic
1113745846 13:112743894-112743916 AACCAGGTCTGAAGGAAAAAGGG + Intronic
1113902678 13:113805413-113805435 CTCCACGTCTGCGGGTAAAATGG - Intronic
1114642762 14:24235194-24235216 CTCCATCTCTAGTGGAAAAAAGG - Intronic
1116408240 14:44592884-44592906 TTCCATTTCTGGAGGACAAATGG + Intergenic
1118701642 14:68439325-68439347 CCCCAGGGCTGGAGGAATCAAGG - Intronic
1119027997 14:71168969-71168991 CCCCAGGGCTGGAGGGAAAAAGG - Intergenic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1121334658 14:93069868-93069890 CACCAGCTCTGGAGAAAACACGG + Intronic
1121555335 14:94832172-94832194 CTCCAGGGCTAGGGGAACAAAGG + Intergenic
1121786336 14:96663831-96663853 ATCCCAGACTGGAGGAAAAAAGG - Intergenic
1122012272 14:98759985-98760007 CTGGAGCTCAGGAGGAAAAATGG - Intergenic
1122274743 14:100585796-100585818 CTCCAGGTTTTGACGACAAACGG + Intronic
1124019878 15:25910319-25910341 GTCAAGGACTGAAGGAAAAAAGG + Intergenic
1124207266 15:27732324-27732346 CTCCAGGTCTGGTGTACAACAGG - Intergenic
1124838233 15:33216171-33216193 CTCCAGGTCTGGAGAGAGCAGGG + Intergenic
1125032822 15:35089750-35089772 TTCCAGGTCTGTAAGAAAATTGG + Intergenic
1125602102 15:40921125-40921147 CTCCAGGTGAGGAGGAAACTGGG - Intergenic
1127862812 15:63008600-63008622 CTCCTGGGCTGAAGGATAAAAGG + Intergenic
1127958600 15:63874025-63874047 GTCTGGGTCTGGGGGAAAAAAGG - Intergenic
1128291845 15:66484150-66484172 CTCCATGTCGGAAGAAAAAAAGG - Intronic
1129002382 15:72345543-72345565 CTCTGGGCCTGGAGGAAAAGGGG + Exonic
1129180444 15:73871100-73871122 TTCCAGGTGGGGAGGAAACAGGG - Intergenic
1129227614 15:74179147-74179169 CTCCAGGTGTGGAGGTAGGAAGG - Intergenic
1129833429 15:78685646-78685668 CTCCCGTCCTGGGGGAAAAATGG + Intronic
1131351705 15:91706916-91706938 CTCCAGGGTTGGAGGAACAAAGG - Intergenic
1132416658 15:101625143-101625165 CTCCAAGTCGGGAGAAGAAAGGG - Intronic
1135230098 16:20698403-20698425 CTGGAGGTCTGGAGGCAGAAAGG + Intronic
1136020006 16:27434254-27434276 CTCGAGGGCTGGAGGAAGAATGG - Intronic
1137732964 16:50702832-50702854 CACAAGCTCTGGAGGAAAACAGG - Intronic
1137821872 16:51453679-51453701 CCCCAGCTCAGGAGGGAAAAAGG - Intergenic
1138468015 16:57207966-57207988 CTGGAGGTGTGGAGGTAAAAAGG - Intronic
1138683634 16:58705756-58705778 CTCCCTGTCTGGAGCAAAAATGG - Intergenic
1139118124 16:63981934-63981956 CTCCAGCTCTGGGAGGAAAAAGG + Intergenic
1142099163 16:88262491-88262513 CTCCACGGCTGGAGGAAGATGGG + Intergenic
1143244077 17:5468434-5468456 CTCCAGGTCTGGCCCAGAAAAGG + Intronic
1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG + Intergenic
1144409950 17:14991206-14991228 CTCGGGGTCTTGAGGAAAAATGG - Intergenic
1144492415 17:15725063-15725085 GGCAAGGTCTGGAGGAAACAAGG + Intergenic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1144908058 17:18654123-18654145 GGCAAGGTCTGGAGGAAACAAGG - Intronic
1147459294 17:40558083-40558105 CCCCAGGTCTGGAGGCCAGAGGG - Intronic
1148656988 17:49292233-49292255 CTCCAGTTTTGGAGGAGAACTGG + Intronic
1150162246 17:62908228-62908250 CCCCAGGTCTGCAGGAAAAGGGG - Intergenic
1151346921 17:73507933-73507955 CTCCAGGGCAGGAGGCAAGAGGG + Intronic
1151468789 17:74304967-74304989 CTCCAGGACTGGAGGAGCCAGGG + Intronic
1152627498 17:81394316-81394338 CTCCCCCTCTGGGGGAAAAAAGG - Intergenic
1156179248 18:34583723-34583745 CTCAAAGACTGGAGGCAAAAAGG + Intronic
1156244061 18:35280858-35280880 TTCCAGTTCTGGGGAAAAAAAGG - Intronic
1156628488 18:38939064-38939086 CTCCAGGTTTGGAGAAAAAGTGG + Intergenic
1157470257 18:47983083-47983105 CTCCAGGTCTGGAGCAGGACTGG + Intergenic
1160049988 18:75424267-75424289 GTCCACGTCAGGACGAAAAATGG + Intronic
1160374505 18:78401269-78401291 CTCCAGGGCAGGAGGAAGAGAGG + Intergenic
1161017272 19:1989504-1989526 ATCCAGCTCTGGAGCAAAACAGG - Intronic
1163314003 19:16530649-16530671 CTGCAGCTCTGGGAGAAAAACGG - Exonic
1164493500 19:28736143-28736165 CTCCGGGGCTTGAGAAAAAAGGG + Intergenic
1165636507 19:37344753-37344775 TTCCGGGGCTGGAGGAATAACGG + Exonic
1165935101 19:39384316-39384338 AGCCAGGGCTGGAGGAAAATGGG - Exonic
1166093488 19:40525282-40525304 ATCCAGGCCTGGATGGAAAAGGG - Intronic
1166387166 19:42388882-42388904 CTCCAGGCCTGGTGGAAGATGGG - Intronic
1168155415 19:54471493-54471515 GTCCCGGTCGGGAGGGAAAAGGG - Intronic
1168419264 19:56190568-56190590 CACCAGATCTGGTGGAAGAAGGG + Exonic
1168534884 19:57160601-57160623 CTCCAGGACTGGAAGTAAAAAGG - Intronic
925785629 2:7429587-7429609 CTCGAAGTCTGGGGGAACAAAGG - Intergenic
926177725 2:10611459-10611481 CTACAAGTGGGGAGGAAAAAGGG + Intronic
926515111 2:13833884-13833906 AGCTAGGTCTTGAGGAAAAACGG - Intergenic
929085203 2:38161161-38161183 CTTCAGTTCTGGAGGAAAGCTGG + Intergenic
929469951 2:42181779-42181801 TTCTAGGGCTGGAGCAAAAAGGG - Intronic
930108490 2:47658335-47658357 CTCCAGGTCTGGAGGGGAGGCGG - Intergenic
930672545 2:54166361-54166383 CTCAAGGACTTGAGGAAAGATGG + Intronic
931092271 2:58898994-58899016 CTCCAGCTCTGGAGGTAATTAGG + Intergenic
934083759 2:88492074-88492096 GACCAAGTCTGGAGGATAAATGG + Intergenic
934457793 2:94189741-94189763 CTACAGGTCAGGAGGAGAAGGGG + Intergenic
934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG + Intronic
937114094 2:119391890-119391912 GCCCAGGTCTGGAGGAAGGAAGG + Intergenic
937129222 2:119494677-119494699 CTCCTGGTCTGCAGGAAAGGTGG + Intronic
937795802 2:126018892-126018914 CTTAAGGTCTAGAGGAAAGATGG - Intergenic
938383072 2:130847565-130847587 CTCAAGGTTTGCAGGTAAAAAGG - Intronic
938923253 2:136014779-136014801 CACGAGGTTTGGAGGACAAAGGG + Intergenic
941034488 2:160553369-160553391 CTCCGGGGCTGGAAGAACAAAGG + Intergenic
941059059 2:160825385-160825407 CTCCAAGTCTTGGGGAAATATGG - Intergenic
941097332 2:161253541-161253563 CTCCATCTCTGAAGAAAAAAAGG + Intergenic
942141897 2:172985373-172985395 TTCCAGGTCTGGGTGGAAAAGGG - Intronic
942606705 2:177699636-177699658 ATGCAGATCTGGAGGAAGAAAGG + Intronic
945169072 2:206977157-206977179 CTTCAGGTCTGCAGGGAAATTGG - Intergenic
945325747 2:208480371-208480393 CTCCAGGTCTGGGGTCATAAGGG - Intronic
945458231 2:210073199-210073221 CTCCAGGGCTGGGGAAGAAAAGG - Intronic
945777471 2:214125149-214125171 CTCCAGCTCAGGTGGAATAAGGG - Intronic
946209814 2:218138376-218138398 CACAAGGACTGGAGGAAACATGG + Intergenic
947668065 2:231919464-231919486 CTTCAGGTCTGGATGTAAAAGGG + Intergenic
947946014 2:234102858-234102880 CTGGAGCTCTGGTGGAAAAAAGG + Intergenic
948314654 2:237018107-237018129 CTACAGGTCAGGAAGAAAACTGG + Intergenic
1168969174 20:1919131-1919153 CTCCAGGCCTCAAGGATAAATGG + Intronic
1169583698 20:7056905-7056927 CTGCAAGTGTGGAAGAAAAATGG - Intergenic
1169720449 20:8670645-8670667 CTCCAGATTTAGGGGAAAAATGG + Intronic
1170602762 20:17854257-17854279 CCCCAGGGCTAGAGGAACAAGGG + Intergenic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1172305260 20:33876113-33876135 CTCCAGGACAAGAGGAAACAGGG - Intergenic
1172924057 20:38514291-38514313 CTCAAAGGCAGGAGGAAAAAGGG - Intronic
1173041506 20:39468352-39468374 TTTCAGTGCTGGAGGAAAAATGG + Intergenic
1173126199 20:40338385-40338407 CTACAGATCTGGAGGAAATTAGG + Intergenic
1173433974 20:43016222-43016244 CCCAGGGTCTGGAGGAAACATGG - Intronic
1173975227 20:47181898-47181920 CTTGAGGTATGCAGGAAAAATGG - Intronic
1174142467 20:48425502-48425524 CACCAGCTCTGGCGGAACAATGG - Intergenic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1175385161 20:58590144-58590166 GTCCAAGCCTGGTGGAAAAAAGG + Intergenic
1176652176 21:9559860-9559882 CTCCAAATCTGGAAAAAAAAAGG - Intergenic
1177844434 21:26272105-26272127 CTCCATGTCTGAAAGGAAAAGGG + Intergenic
1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG + Intergenic
1178065884 21:28903832-28903854 CTCATGGTCTGCAGGTAAAAAGG - Intergenic
1178785910 21:35653024-35653046 CTCTTGGACTGGAGGAACAATGG - Intronic
1182091959 22:27602109-27602131 CTTCAGGGCTGGGGGTAAAATGG - Intergenic
1182942079 22:34286467-34286489 CCCCAGGGCTGGAGGAACATGGG - Intergenic
1183806471 22:40215646-40215668 CCCCAGGGCTGGGGGAACAAAGG - Intronic
1184387281 22:44183236-44183258 CTCCAGGTCTAGAGAAAATGAGG + Intronic
1185059735 22:48600047-48600069 CTCAAGGTCTGGCAGAAACAGGG - Intronic
1185122519 22:48980897-48980919 CAGCAGATCTGGAGGAAATATGG - Intergenic
949611352 3:5706953-5706975 CTTCAGGACTGGAGGATAGATGG - Intergenic
950717827 3:14862295-14862317 CTCCAAGTCTGCTGGAAAAAGGG + Intronic
950803130 3:15571525-15571547 CCCCAGGTCTCATGGAAAAAGGG - Intronic
950831952 3:15883481-15883503 GTTCAGACCTGGAGGAAAAATGG - Intergenic
951041288 3:17991319-17991341 ATCCAGGTCTGGACCAAAAATGG + Intronic
951621542 3:24607178-24607200 CTCAAGGTCAGGGGGAGAAACGG - Intergenic
951892782 3:27582593-27582615 CACCAGGTCTGGAGTAAGGAGGG + Intergenic
951964961 3:28371820-28371842 CTCCAGGCCTAGGGGAAAAGAGG + Intronic
952616450 3:35278783-35278805 CTCCAGGTATGGAAAAAAACCGG + Intergenic
952998856 3:38912100-38912122 CTCCAGGTCTGGTGAGAAAGAGG - Intronic
953393098 3:42545264-42545286 CCCCAGGGCTGGGGGAATAAAGG + Intergenic
954576905 3:51681351-51681373 CTCCAGGCCTCTAGGCAAAAAGG - Intronic
955029338 3:55201226-55201248 AGCCAGGCCTGGAGGGAAAATGG - Intergenic
955745860 3:62139856-62139878 CTCCAGGCCTCTAGCAAAAAAGG + Intronic
957530985 3:81440636-81440658 TTCCAGTCCTGGAGGAGAAAAGG + Intergenic
957905490 3:86548326-86548348 CTCCCAGTCTGTAGGAAATAGGG + Intergenic
959527763 3:107396961-107396983 CTCCTGGTCTGAAGGGAAAGAGG - Intergenic
960689238 3:120326686-120326708 CTCTACCTCTGGATGAAAAAAGG + Exonic
961148568 3:124616493-124616515 CCCTAGATCTGGAAGAAAAAGGG - Intronic
962607852 3:137047333-137047355 CCCCAGGTCTGCAGGCAAATTGG + Intergenic
962863481 3:139426193-139426215 CTCACCATCTGGAGGAAAAAGGG - Intergenic
964182454 3:153904843-153904865 CTCCAGGTCCGGAGGACTCAGGG - Intergenic
964946055 3:162225017-162225039 ATCCAGGACTGAAAGAAAAAAGG + Intergenic
966493391 3:180552990-180553012 CTCCAGTTCTGTAGGGAGAAAGG - Intergenic
972734071 4:41823220-41823242 CTGAAGGTAAGGAGGAAAAAAGG + Intergenic
972858914 4:43142701-43142723 TTGGAGGTCTGGAGGAGAAAGGG - Intergenic
975258410 4:72267796-72267818 CTCTAGGTCTGGAAGGAATATGG + Intergenic
975924269 4:79430191-79430213 GTCGAGGGCTGGAGGAAAGATGG - Intergenic
975983960 4:80186285-80186307 TTCCAGTTCTGGAAAAAAAAAGG - Intronic
978665045 4:111172434-111172456 TTATAGGTCTGGAGGTAAAAAGG - Intergenic
983461765 4:168033577-168033599 CTCCATGTCTTGAGAAAAAAAGG - Intergenic
983591069 4:169411934-169411956 CTCCAGATAAGGAGGAGAAATGG + Intronic
989679135 5:44008677-44008699 GGCCAGGTCTCCAGGAAAAAGGG - Intergenic
990989957 5:61674954-61674976 CTCCAGGACTGGAGAAAAGAGGG + Intronic
991289203 5:65015700-65015722 CTCAATGACTGGAGAAAAAAAGG + Intronic
992429767 5:76697799-76697821 TTCCAGTTCTGAAGTAAAAAGGG + Intronic
992434540 5:76742675-76742697 CTCTGGGTCTGGCTGAAAAATGG + Intergenic
995002392 5:107149926-107149948 CTTCATGTCTGGAGAAAAACTGG + Intergenic
995122482 5:108551093-108551115 AGCTAGGTCTGGAGGAAAATTGG + Intergenic
995514536 5:112940904-112940926 CTGCAGGGCTGCAAGAAAAAGGG + Intergenic
998234979 5:140390815-140390837 TTCCAACTCTGGAGGAAAAGTGG - Intergenic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
999924937 5:156364834-156364856 CTACAGTTCTGGAGAGAAAATGG - Intronic
1000024218 5:157344881-157344903 CTCCACTCCTGGAGGAAAATGGG - Intronic
1000243757 5:159432121-159432143 CTCCAGGTTTCCAAGAAAAAAGG + Intergenic
1000307841 5:160012023-160012045 CACCAGAACAGGAGGAAAAAGGG + Intronic
1000472171 5:161657586-161657608 CTCAAGGTCAGGAGAAAAAATGG + Intronic
1001093399 5:168758009-168758031 CTCCCGGTGTGGAAGGAAAATGG - Intronic
1002865128 6:1115104-1115126 TTCCTGGTATGGAGTAAAAACGG + Intergenic
1004878046 6:19976074-19976096 CTCCAGGCCTTGGGGGAAAATGG - Intergenic
1005162825 6:22884145-22884167 TTACAGGTCTGCAGGGAAAATGG - Intergenic
1005264882 6:24101233-24101255 CAACAGGGCTGGAGGAAAATGGG + Intergenic
1006762847 6:36478549-36478571 GTCGAGCTCTGGGGGAAAAATGG - Intronic
1007296181 6:40823135-40823157 CTCCAGGCCAGGAGAATAAAGGG + Intergenic
1007779570 6:44245200-44245222 CTCCATTTCTGGAGCAGAAAGGG + Intergenic
1007923104 6:45628597-45628619 CCCTAGGGCTGGAGGAACAAAGG + Intronic
1009655221 6:66535671-66535693 CTCCAGAACAGGAGGATAAAAGG + Intergenic
1010053530 6:71536621-71536643 CTCCAGGTCTATATGAAAAGTGG + Intergenic
1012097509 6:94981892-94981914 TTCCAGGTCTGAAGTAAAAATGG - Intergenic
1012296839 6:97534482-97534504 ATACAGGTCTGGAAGAAAATAGG + Intergenic
1012579223 6:100844751-100844773 CTCAAGGTAGGGAGGGAAAAGGG + Intronic
1013182618 6:107731033-107731055 CTCCAGGACTGTAGCAGAAATGG - Intronic
1015116006 6:129650272-129650294 CACCAGGTCTTGTAGAAAAAAGG + Intronic
1016887191 6:148969662-148969684 CTCCAGGTCTGGAGGAAAAATGG - Intronic
1017603061 6:156104572-156104594 CTCCAGGACCAGAGGACAAATGG - Intergenic
1017873663 6:158506078-158506100 CTCCAAGTTTGCAGGAAATAAGG - Intronic
1020020477 7:4863942-4863964 CTCTAGGGCTGGAAGAAAAAGGG - Intronic
1021566062 7:22017584-22017606 GTCCAGGTCAGGAAGAAGAAGGG - Intergenic
1024149787 7:46559308-46559330 TTCCAGCTCTTGAGGAGAAACGG + Intergenic
1025730183 7:64101486-64101508 ATCCAAGTCAGGAGGAAAACAGG - Intronic
1027209684 7:76135537-76135559 CTCCTGGGTTGGAGGCAAAAGGG - Intergenic
1027581834 7:80006368-80006390 CTCCAGGTCTGAAGATAAGAAGG + Intergenic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1028069922 7:86438948-86438970 CTAGAGTACTGGAGGAAAAATGG - Intergenic
1028150755 7:87368494-87368516 CCCTAGGTCTTGAGGAAATAAGG + Intronic
1028746413 7:94332203-94332225 CTCCATGTCTGGAGGACATCTGG + Intergenic
1031337481 7:120554080-120554102 CTCCAGGTCAGCAGGAAAATAGG - Intronic
1032510126 7:132465810-132465832 CTCCAGCTCTGCAGGAAAAGTGG - Intronic
1033024657 7:137760627-137760649 CTCCAGAAATGGAGGAGAAAGGG + Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034699865 7:153086520-153086542 CTGCAGGTGTGGAGGAAAGGAGG - Intergenic
1035283397 7:157791799-157791821 CTCCAGGTCCTCAGGAAACATGG - Intronic
1036603721 8:10287719-10287741 ATCCAGGTCTGAAACAAAAATGG - Intronic
1037502058 8:19495829-19495851 CTCCAGGCCTGCAGGAGGAAGGG + Intronic
1037911816 8:22748169-22748191 CCCCAGATCTGGAGAGAAAAGGG + Intronic
1039608687 8:38902151-38902173 CTTTAGGACTGGAGGAGAAAAGG - Intronic
1040923575 8:52651703-52651725 CTCAAAGTGGGGAGGAAAAAGGG + Intronic
1041648494 8:60277909-60277931 CTCCAGGGAGGCAGGAAAAAAGG + Intronic
1043817448 8:84819064-84819086 CTCTATGTCTGCAGGGAAAAAGG + Intronic
1048013357 8:130476389-130476411 CTCTTGGTCTGGGAGAAAAAGGG + Intergenic
1048461252 8:134623483-134623505 ATGCAGATTTGGAGGAAAAAGGG - Intronic
1048846956 8:138611181-138611203 CTCCATTTCTGGAGGCAAGAGGG - Intronic
1049269460 8:141686533-141686555 CTCCACGTCTGGAGGGGAGACGG + Intergenic
1050227789 9:3480403-3480425 TTCCAGGTCTGGGTGCAAAAAGG - Intronic
1053649986 9:40157741-40157763 CTCAAGATCTGGTGAAAAAATGG + Intergenic
1053755754 9:41306186-41306208 CTCAAGATCTGGTGAAAAAACGG - Intergenic
1054330494 9:63749499-63749521 CTCAAGATCTGGTGAAAAAATGG + Intergenic
1054534595 9:66218462-66218484 CTCAAGATCTGGTGAAAAAATGG - Intergenic
1055124050 9:72698680-72698702 CCCAAGGGCTGGAGGAACAATGG + Intronic
1056509056 9:87285439-87285461 CTCCTGGGCTGGAGCAAACACGG - Intergenic
1057062429 9:92017569-92017591 CAGCAGGTGTGAAGGAAAAATGG + Intergenic
1060122556 9:121008189-121008211 CTCCAGGTCAGAATGAAGAAGGG - Intronic
1060545615 9:124457457-124457479 CTCCAGGCCTGGGGGTAAATGGG - Exonic
1060814520 9:126627577-126627599 CTCCAGCTCTGGGGAAAGAAGGG - Intronic
1061729491 9:132602566-132602588 CTCTAGGTCTGGAAGCAGAACGG - Intronic
1062010444 9:134264110-134264132 CTCCACTTCTGGATGAAAAGAGG + Intergenic
1062327732 9:136020221-136020243 ATGCAGGTCTGGAGGGAAACCGG + Intronic
1202797875 9_KI270719v1_random:142417-142439 CTCAAGATCTGGTGAAAAAACGG + Intergenic
1203629904 Un_KI270750v1:63405-63427 CTCCAAATCTGGAAAAAAAAAGG - Intergenic
1186154431 X:6710855-6710877 CTCCAGCTATGGAGGAAAACTGG - Intergenic
1187135417 X:16542870-16542892 TTCCAGGTCTGGAGCAGGAAAGG + Intergenic
1189122575 X:38410455-38410477 TTCTAAATCTGGAGGAAAAATGG + Intronic
1189171963 X:38917692-38917714 ATCCAGGCCTGGAAGAAAAATGG + Intergenic
1189952726 X:46248900-46248922 CTCAAGGTCTGAAGGGACAAGGG - Intergenic
1190754241 X:53387658-53387680 TTCCAGGTCTGGGTGGAAAATGG + Intronic
1192210052 X:69122043-69122065 CTCCTGGTATGCAGGGAAAATGG + Intergenic
1193862930 X:86693511-86693533 CTTCAGGACTGGAGTAAAAGTGG + Intronic
1193918501 X:87397417-87397439 CTCAAGGTCTAGCTGAAAAAAGG + Intergenic
1194964774 X:100275167-100275189 ACCCAGGTCTGAAGGGAAAATGG - Intergenic
1195231352 X:102852170-102852192 CTCCAGGTCTGGGGTAGGAATGG - Intergenic
1195349855 X:103985748-103985770 CTCCAGGACAGGGGGAGAAATGG + Intergenic
1195352072 X:104005395-104005417 CTCCAGGACAGGGGGAGAAATGG - Intergenic
1195357588 X:104053091-104053113 CTCCAGGACAGGGGGAGAAATGG - Intergenic
1195573447 X:106422698-106422720 CTCCCCTTCTGGATGAAAAATGG - Intergenic
1195975756 X:110524496-110524518 CCCCATGTCTGGAGGAACATTGG - Intergenic
1196108179 X:111918196-111918218 CTCAGAGACTGGAGGAAAAAAGG + Intronic
1196595557 X:117541671-117541693 ATTCTGGTCTGGAGGAGAAATGG - Intergenic
1196630348 X:117931424-117931446 CTCCAGGTCTTAAGGATGAAAGG + Intronic
1197292224 X:124672878-124672900 GTTCATGTCTGGAGAAAAAAAGG + Intronic
1197757492 X:130006003-130006025 ATCTAGGTCTGGAAGAAAGATGG + Intronic
1198754728 X:139970971-139970993 CTCCAGGGGTAGAGGAAAAGTGG + Intergenic
1199053784 X:143268492-143268514 ATTCAAGTCTGGAAGAAAAATGG + Intergenic
1199169651 X:144721178-144721200 CTGCAGCTCAGAAGGAAAAAAGG + Intergenic
1199274350 X:145924052-145924074 CTCCAGTTCTGTTGGAAGAAAGG - Intergenic
1199489747 X:148385252-148385274 CACATGCTCTGGAGGAAAAATGG - Intergenic