ID: 1016887891

View in Genome Browser
Species Human (GRCh38)
Location 6:148975492-148975514
Sequence CACACTGGACACTTTGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 374}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016887891 Original CRISPR CACACTGGACACTTTGATCA TGG (reversed) Intronic
901919293 1:12524995-12525017 CACTTTGGACACATTGAACATGG + Intergenic
902673993 1:17995696-17995718 CGCCTTGGACACTTTGATCTTGG - Intergenic
902815513 1:18914265-18914287 CACACTGGAGCCTTTGCCCATGG + Intronic
904179326 1:28654809-28654831 CACCATGGCCACTTTGTTCATGG + Intergenic
905400040 1:37694705-37694727 GAAATTGGACACTTTGCTCAAGG + Intronic
906050604 1:42868258-42868280 CACCATGGCCACTTTGTTCATGG - Intergenic
908736424 1:67281845-67281867 CAAACTGGATAATTTGAGCAAGG + Intergenic
908737504 1:67291661-67291683 CACCATGGCCACTTTGTTCATGG - Intergenic
909172487 1:72314617-72314639 CACCATGGCCACTTTGTTCATGG + Intergenic
909701872 1:78533979-78534001 AACACTGGACACTAAGATAAGGG - Intronic
909811062 1:79932178-79932200 CACCATGGCCACTTTGTTCATGG - Intergenic
910370754 1:86512979-86513001 CACCATGGCCACTTTGTTCATGG - Intergenic
910638869 1:89439126-89439148 CACTATGGCCACTTTGTTCATGG + Intergenic
910790449 1:91044591-91044613 CACCATGGTCACTTTGTTCATGG - Intergenic
910830982 1:91462573-91462595 CACCATGGCCACTTTGTTCATGG + Intergenic
910948329 1:92617556-92617578 CACCATGGCCACTTTGTTCATGG - Intronic
911109053 1:94163856-94163878 CACCATGGCCACTTTGTTCATGG + Intronic
911257220 1:95646514-95646536 CACCATGGCCACTTTGTTCATGG + Intergenic
911847872 1:102777175-102777197 CACAATGAAGACTGTGATCATGG - Intergenic
912129796 1:106587209-106587231 CACCATGGACACTGTGTTCATGG + Intergenic
912943690 1:114067358-114067380 CACCATGGCCACTTTGTTCATGG + Intergenic
912969800 1:114270092-114270114 CACACCGGAGCCTTTGACCAGGG - Intergenic
914965394 1:152253058-152253080 CACCATGGACACTTTGTTCATGG + Intergenic
915242899 1:154536448-154536470 AACACTGGAGGCTTTGAGCAGGG + Intronic
916285446 1:163100368-163100390 CACTGTGGCCACTTTGTTCATGG - Intergenic
917462821 1:175247005-175247027 CACCATGGCCACTTTGTTCACGG - Intergenic
918774613 1:188611595-188611617 CACCATGGCCACTTTGTTCATGG - Intergenic
919241882 1:194925053-194925075 CACCATGGCCACTTTGTTCATGG - Intergenic
919330318 1:196162775-196162797 CACCATGGACATTTTGTTCATGG - Intergenic
1063021258 10:2130557-2130579 CAAATTTGACAGTTTGATCATGG - Intergenic
1065744870 10:28831320-28831342 CACACAGGACACTTTGCTTAAGG + Intergenic
1066166908 10:32798380-32798402 CACCATGGCCACTTTGTTCATGG + Intronic
1066169552 10:32827169-32827191 CACCATGGCCACTTTGTTCATGG - Intronic
1067125434 10:43511698-43511720 CACCATGGCCACTTTGTTCATGG + Intergenic
1067754235 10:48992870-48992892 CACCATGGCCACTTTGTTCATGG + Intergenic
1068007555 10:51408732-51408754 CACCATGGCCACTTTGTTCATGG + Intronic
1068011991 10:51463819-51463841 CACACTGGATACTTTAATGAGGG - Intronic
1068447314 10:57139442-57139464 CACCATGGCCACTTTGTTCATGG - Intergenic
1068908958 10:62358104-62358126 CACCATGGCCACTTTGTTCATGG - Intergenic
1069192191 10:65505522-65505544 CACCGTGGCCACTTTGTTCATGG + Intergenic
1069515189 10:69071807-69071829 AACTCTGGACACTTTTGTCAGGG - Intergenic
1071937805 10:90550126-90550148 CACAATGGCCACTTTGTTCATGG - Intergenic
1071942668 10:90606926-90606948 CACCATGGCCACTTTGTTCATGG + Intergenic
1072099293 10:92214359-92214381 CCCACTGGCAACTTTGATCTTGG + Intronic
1072496920 10:95970835-95970857 CACACTGGTCCCTTTGACAAAGG - Intronic
1072769847 10:98128529-98128551 CAAAATGGACAGTTTGAACAAGG - Intergenic
1073557469 10:104466741-104466763 CACCATGGCCACTTTGTTCATGG - Intergenic
1076777674 10:132707085-132707107 CACGCTGGACCCTTTCTTCACGG + Intronic
1076872269 10:133199912-133199934 CACACTGGTCCCTCTGAGCAGGG - Intronic
1076927287 10:133498368-133498390 CACCATGGCCACTTTGTTCACGG + Intergenic
1079331558 11:19537298-19537320 CACACTGGGCAGTTTATTCATGG - Intronic
1079630529 11:22668382-22668404 CACATTGGAGACTTTGCACAGGG + Intronic
1081072905 11:38632019-38632041 CACCGTGGCCACTTTGTTCATGG - Intergenic
1081378402 11:42386751-42386773 CACCATGGCCACTTTGTTCATGG - Intergenic
1081609177 11:44548702-44548724 CACCATGGCCACTTTGTTCATGG - Intergenic
1082999774 11:59280687-59280709 CACCATGGACACTTTGTTCATGG - Intergenic
1084943095 11:72624845-72624867 CACACAGTACCCTATGATCATGG + Intronic
1085267771 11:75247349-75247371 CACACAGGACACTGTGATCATGG + Intergenic
1085836940 11:79966901-79966923 CACACTGGACTCTGAGATCCTGG + Intergenic
1086278721 11:85161272-85161294 CACCATGGCCACTTTGTTCATGG - Intronic
1086356275 11:86003851-86003873 GACACTGAACACTGTCATCAGGG + Intronic
1088265537 11:107984424-107984446 CACCATGGCCACTTTGTTCATGG - Intergenic
1088449464 11:109966176-109966198 CACCATGGCCACTTTGTTCATGG - Intergenic
1089227357 11:116936852-116936874 CATGCTGTACACTTTGCTCAGGG + Intronic
1089903732 11:122014436-122014458 CATAATGGCCACTTTGTTCATGG - Intergenic
1091022944 11:132117339-132117361 CAGACTGGAAACTCTGAGCATGG + Intronic
1091268773 11:134290935-134290957 TTCCCTGGAGACTTTGATCATGG + Intronic
1091931077 12:4395759-4395781 CACCCTGGAAATTTTGAGCAGGG + Intergenic
1092093397 12:5822458-5822480 CACCATGGCCACTTTGTTCATGG - Intronic
1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG + Intergenic
1092381663 12:8001747-8001769 CACCATGGCCACTTTGTTCATGG - Intergenic
1093031750 12:14295111-14295133 CACCATGGCCACTTTGTTCATGG + Intergenic
1093208775 12:16282967-16282989 CACACTGGACAGAAGGATCAAGG - Intergenic
1093964654 12:25311775-25311797 CACCATGGCCACTTTGTTCATGG - Intergenic
1094389677 12:29935399-29935421 CACCATGGACACTTTGTTCATGG + Intergenic
1095121396 12:38424015-38424037 CACAATGGCCACTTTGTTCATGG + Intergenic
1095397523 12:41777562-41777584 CACACTGGACGCCTTGACCAAGG + Intergenic
1095844273 12:46729150-46729172 CACCATGGCCACTTTGTTCATGG + Intergenic
1095856138 12:46862852-46862874 CACCATGGCCACTTTGTTCATGG + Intergenic
1097773890 12:63623375-63623397 CACACAGAACACTTTTTTCATGG + Intronic
1097821236 12:64131084-64131106 CACTATGGCCACTTTGTTCATGG + Intronic
1098259188 12:68650397-68650419 CAGACTGTACAATTTGTTCAAGG + Exonic
1098673136 12:73255068-73255090 CACTATGGCCACTTTGTTCATGG - Intergenic
1098716213 12:73830628-73830650 CACCGTGGCCACTTTGTTCATGG - Intergenic
1098733405 12:74066455-74066477 CACCATGGCCACTTTGTTCATGG - Intergenic
1099689886 12:85938845-85938867 CACCATGGCCACTTTGTTCATGG - Intergenic
1099700773 12:86078726-86078748 CACCATGGCCACTTTGTTCATGG + Intronic
1101264253 12:103066940-103066962 CACCATGGCCACTTTGTTCATGG - Intergenic
1101543182 12:105683459-105683481 CACCATGGCCACTTTGTTCATGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103035739 12:117654896-117654918 CACCGTGGCCACTTTGTTCATGG - Intronic
1105530588 13:21215569-21215591 CAAACCTGACACTTTGATCCTGG + Intergenic
1105740231 13:23316005-23316027 CACCATGGCCACTTTGTTCATGG - Intronic
1108914192 13:55588064-55588086 CACCATGGCCACTTTGTTCATGG + Intergenic
1109293335 13:60500939-60500961 CACCATGGCCACTTTGTTCATGG - Intronic
1109712574 13:66180008-66180030 CACCATGGCCACTTTGTTCATGG + Intergenic
1110377278 13:74807335-74807357 CACCATGGCCACTTTGTTCATGG - Intergenic
1111057680 13:82972201-82972223 CACCATGGTCACTTTGTTCATGG + Intergenic
1111317611 13:86582623-86582645 CACCATGGCCACTTTGTTCATGG - Intergenic
1111334232 13:86800536-86800558 TACACTGGACCCTTTCATCATGG - Intergenic
1112057608 13:95705193-95705215 CACCATGGCCACTTTGTTCATGG + Intronic
1112231008 13:97589347-97589369 CACCATGGCCACTTTGTTCATGG + Intergenic
1113118430 13:106899642-106899664 CACACTGGACTGTTTGCTTAAGG - Intergenic
1113223847 13:108137394-108137416 CACACAGAGCACTTTGTTCAGGG - Intergenic
1114758137 14:25283055-25283077 CACCATGGCCACTTTGTTCATGG + Intergenic
1114905280 14:27119735-27119757 CACCATGGCCACTTTGTTCATGG + Intergenic
1116059016 14:39897750-39897772 CACCATGGCCACTTTGTTCATGG - Intergenic
1116068205 14:40009992-40010014 CACCATGGCCACTTTGTTCATGG - Intergenic
1116415177 14:44670118-44670140 CACCATGGCCACTTTGTTCATGG - Intergenic
1116531346 14:45977416-45977438 CACCATGGCCACTTTGTTCATGG + Intergenic
1117596160 14:57329060-57329082 CACCATGGTCACTTTGTTCATGG + Intergenic
1117634252 14:57725199-57725221 CACCATGGCCACTTTGTTCATGG - Intronic
1118122324 14:62859355-62859377 CACCATGGCCACTTTGTTCATGG + Intronic
1118880659 14:69823192-69823214 CACCATGGCCACTTTGTTCATGG + Intergenic
1118950640 14:70433750-70433772 CACCATGGCCACTTTGTTCATGG + Intergenic
1119107443 14:71938019-71938041 CACCATGGCCACTTTGTTCATGG + Intronic
1119176848 14:72574798-72574820 CACACTGCACACTCTGCTCATGG - Intergenic
1120081903 14:80226709-80226731 CACCATGGCCACTTTGTTCATGG + Intronic
1120179323 14:81327381-81327403 CACAATCTACATTTTGATCATGG + Intronic
1120973816 14:90231621-90231643 CACAATAGCCACTTTGTTCATGG - Intergenic
1125483933 15:40099247-40099269 CAGACTGGATCCTTTGTTCAGGG - Intronic
1127775989 15:62264628-62264650 CTCACTGGACCCTTTGGTCCTGG + Intergenic
1128441389 15:67712352-67712374 CTCACTGGAAACTGTGCTCATGG - Intronic
1128578736 15:68793859-68793881 CAAACTGTCCACTTTAATCAGGG - Intronic
1129788645 15:78325752-78325774 CACACAGGACATTATGCTCAAGG + Intergenic
1131724131 15:95203623-95203645 CACCATGGCCACTTTGCTCATGG - Intergenic
1137374405 16:47940448-47940470 CTCACTGTACACTTTGAAGAAGG + Intergenic
1138212150 16:55172634-55172656 GGCACTGGGCACTTTGAGCATGG + Intergenic
1146238099 17:31186771-31186793 CACCATGGCCACTTTGTTCATGG - Intronic
1146836469 17:36114798-36114820 CACCATGGCCACTTTGTTCATGG - Intergenic
1146851050 17:36221857-36221879 CACCATGGCCACTTTGTTCATGG - Intronic
1149542490 17:57478134-57478156 CACACTGGGCACATTGATGGCGG + Intronic
1150524032 17:65902963-65902985 CACACTGGAGACTGTGACCTTGG + Intronic
1151037688 17:70820775-70820797 CACCATGGACACTTGGTTCATGG + Intergenic
1152697651 17:81804774-81804796 CACACTGGCGACTTTGACCCCGG + Intronic
1203169408 17_GL000205v2_random:134538-134560 CACACTGGACACCTGTTTCATGG + Intergenic
1153089826 18:1330983-1331005 CACCACGGACACTTTGTTCATGG - Intergenic
1154506275 18:15043709-15043731 CACCATGGCCACTTTGTTCATGG - Intergenic
1156303969 18:35859515-35859537 CACCATGGCCACTTTGTTCATGG - Intergenic
1156998686 18:43498549-43498571 CACCATGGCCACTTTGTTCATGG - Intergenic
1157341322 18:46780832-46780854 CACCATGGCCACTTTGTTCATGG - Intergenic
1159558991 18:69974543-69974565 CACCATGGCCACTTTGTTCATGG + Intergenic
1159711405 18:71764942-71764964 CACCATGGCCACTTTGTTCATGG - Intronic
1160092558 18:75840835-75840857 CACCATGGCCACTTTGTTCATGG - Intergenic
1160615844 18:80127641-80127663 CACACTGGACATTGTGTTTATGG + Intronic
1160786370 19:901782-901804 CCCCCTGGACTCTTGGATCAGGG - Intronic
1163638235 19:18447475-18447497 CATCATGGACACTTTGCTCATGG - Intronic
1164083096 19:21877623-21877645 CACAATGGCCACTATGCTCAGGG - Intergenic
1168200184 19:54809387-54809409 CACACTGCACAGTCTGAGCATGG - Intronic
925460837 2:4061262-4061284 CACCGTGGCCACTTTGTTCAGGG - Intergenic
925772629 2:7298194-7298216 CACAATGGCCACTTTGTTCATGG + Intergenic
926212879 2:10884228-10884250 CACACTGTACACTTTCCACAAGG + Intergenic
926703517 2:15819960-15819982 CATTCTGGACACTTTAATAATGG + Intergenic
926826881 2:16914489-16914511 CACCTTGGCCACTTTGTTCATGG - Intergenic
927848103 2:26481909-26481931 CACAGTGAGCACTTTGATCCAGG + Intronic
928322997 2:30298069-30298091 TCCACTGGACACTTTGAAGAAGG - Intronic
930536507 2:52651445-52651467 CACCATGGCCACTTTGTTCATGG + Intergenic
932603127 2:73143898-73143920 CACACTGGCCAGCTTGATAAGGG - Intronic
932870586 2:75394263-75394285 CACCATGGCCACTTTGGTCATGG + Intergenic
933504669 2:83161948-83161970 CACCATGGCCACTTTGTTCATGG + Intergenic
935184059 2:100715718-100715740 CACCATGGCCACTTTGTTCATGG - Intergenic
935424994 2:102910505-102910527 CACCATGGCCACTTTGTTCATGG + Intergenic
936084876 2:109460494-109460516 CACAGTGGCCACTCTGTTCATGG + Intronic
936332247 2:111557726-111557748 CACACTGGACACACAGATCTTGG - Intergenic
936964499 2:118114260-118114282 CACACTTAACACTTACATCATGG + Intergenic
939069194 2:137518707-137518729 CACAATGGCCACTGTGGTCATGG - Intronic
939213983 2:139213058-139213080 CACCATGGCCACTTTGTTCATGG - Intergenic
939296344 2:140269657-140269679 CACTCTGGACAATCAGATCATGG + Intronic
939528213 2:143323031-143323053 CAAACTGGAAGCTTTGGTCAAGG - Intronic
940171194 2:150831889-150831911 CACCATGGCCACTTTGTTCATGG + Intergenic
940335154 2:152519094-152519116 CACACTGGGCACAGTGAACAAGG - Intronic
940471978 2:154112304-154112326 CACCATGGCCACTTTGTTCATGG + Intronic
941720012 2:168802582-168802604 CATTCTGGACACTGTAATCAAGG - Exonic
943517481 2:188906435-188906457 TACCATGGACACTTTGTTCATGG + Intergenic
946527760 2:220539215-220539237 CACCATGGCCACTTTGTTCATGG + Intergenic
947014712 2:225606265-225606287 ACCTCTGGACACTTTGATCTGGG - Intronic
947440960 2:230121074-230121096 CACCATGGCCACTTTGTTCATGG - Intergenic
948089980 2:235285333-235285355 CTCACTGGAGACTTTTTTCATGG + Intergenic
1168862478 20:1055654-1055676 CACACAGTACACTTTGCACAGGG + Intergenic
1170174450 20:13453392-13453414 CACAATGGTCACATTAATCAGGG + Intronic
1171182033 20:23098076-23098098 CACACTGGACACTTCCAGGAGGG - Intergenic
1172386703 20:34539026-34539048 CAAACTGCAAACATTGATCAAGG - Intronic
1172576645 20:36014288-36014310 CACACTTAACACTTGGATCTTGG + Intronic
1176124770 20:63470578-63470600 CACGCTGGGCCCTTGGATCATGG + Intronic
1176332526 21:5561174-5561196 CACACTGGACACCTGTTTCATGG - Intergenic
1176395231 21:6259777-6259799 CACACTGGACACCTGTTTCATGG + Intergenic
1176402350 21:6324611-6324633 CACACTGGACACCTGTTTCATGG - Intergenic
1176434807 21:6664493-6664515 CACACTGGACACCTGTTTCATGG + Intergenic
1176441926 21:6729327-6729349 CACACTGGACACCTGTTTCATGG - Intergenic
1176459069 21:6991563-6991585 CACACTGGACACCTGTTTCATGG + Intergenic
1176466188 21:7056396-7056418 CACACTGGACACCTGTTTCATGG - Intronic
1176489749 21:7438174-7438196 CACACTGGACACCTGTTTCATGG - Intergenic
1176791579 21:13325314-13325336 CACCATGGCCACTTTGTTCATGG + Intergenic
1176998282 21:15581088-15581110 CACCATGGCCACTTTGTTCATGG - Intergenic
1178012772 21:28306000-28306022 CACCATGGCCACTTTGTTCATGG - Intergenic
1179248413 21:39652701-39652723 CAAACTTCACAGTTTGATCAAGG + Intronic
1182753984 22:32663939-32663961 CACACTGCACATTTTGAAAAAGG + Intronic
1182965822 22:34520119-34520141 CACCATGGCCACTTTGTTCATGG - Intergenic
1184603450 22:45557545-45557567 CACCATGGCCACTTTGTTCATGG + Intronic
949134170 3:542398-542420 AATACTGGACATTTTGAACAAGG + Intergenic
949417464 3:3830068-3830090 CACCATGGCCACTTTGTTCATGG + Intronic
949445726 3:4131879-4131901 CACCATGGCCACTTTGTTCATGG - Intronic
949763072 3:7494813-7494835 CAAACTGCAGACTTTCATCAAGG - Intronic
951282800 3:20773510-20773532 CACTCTGGACACTATGACCCAGG + Intergenic
951291410 3:20875922-20875944 CACTATGGCCACTTTGTTCATGG + Intergenic
951970652 3:28441066-28441088 CACCATGGCCACTTTGTTCATGG + Intronic
952575601 3:34770525-34770547 CACACTTACCACTTAGATCATGG - Intergenic
952998496 3:38908364-38908386 CATACTGGACACTGTGCTAAGGG - Intronic
956515420 3:70041165-70041187 TACACTGGACACTTTGGCAAAGG - Intergenic
956703786 3:71982068-71982090 CACCATGGCCACTTTGTTCATGG + Intergenic
957272886 3:78054406-78054428 CATACTAGGCACTTTGAACATGG + Intergenic
957754702 3:84470248-84470270 CACCATGGCCACTTTGTTCATGG - Intergenic
958730102 3:97952277-97952299 CAGCCTGGACACATTGATCATGG + Intronic
959745903 3:109776454-109776476 CACCATGGCCACTTTGTTCATGG + Intergenic
959997981 3:112699140-112699162 CACTATGGCCACTTTGTTCATGG - Intergenic
960721359 3:120627466-120627488 CACAGTGGAAATTTTTATCATGG + Intergenic
961535878 3:127570226-127570248 AACAGTGGACACCTTGATCTTGG + Intergenic
962462816 3:135630341-135630363 CAAAATGGACACTTTGATGGAGG - Intergenic
963379130 3:144506463-144506485 CACCATGGCCACTTTGTTCATGG + Intergenic
963970202 3:151421133-151421155 CACCATGGCCACTTTGTTCATGG + Intronic
964195651 3:154061485-154061507 CAAAGTGGATACTTTGATCATGG - Intergenic
964679122 3:159318093-159318115 CACCATGGCCACTTTGTTCATGG + Intronic
965226648 3:165999950-165999972 CACCGTAGACACTTTGTTCATGG + Intergenic
967223040 3:187265324-187265346 CACACTGGTCATTTGGATTAGGG + Intronic
967831904 3:193926809-193926831 CACCATGGCCACTTTGTTCATGG - Intergenic
968907127 4:3459232-3459254 CACCATGGCCACTTTGTTCATGG - Intergenic
971678986 4:29672605-29672627 CACTCAGCACACTTTTATCATGG - Intergenic
971945108 4:33265400-33265422 AATAGTGGAGACTTTGATCAAGG - Intergenic
972806034 4:42530149-42530171 CACCATGGCCACTTTGTTCATGG - Intronic
973120887 4:46520083-46520105 CACCATGGCCACTTTGTTCATGG + Intergenic
973130068 4:46638870-46638892 CACCATGGCCACTTTGTTCATGG + Intergenic
973865091 4:55104748-55104770 CACAAATGACATTTTGATCATGG - Exonic
974019186 4:56677898-56677920 CACACTGGGCACTCTGTTCTGGG - Intronic
974644500 4:64673946-64673968 CACCATGGCCACTTTGTTCATGG + Intergenic
975386605 4:73766692-73766714 CACCATGGCCACTTTGCTCACGG + Intergenic
976034094 4:80795002-80795024 CACCATGGCCACTTTGTTCATGG + Intronic
977466121 4:97384196-97384218 CACCATGGCCACTTTGTTCATGG - Intronic
977489968 4:97699253-97699275 CACCATGGCCACTTTGTTCATGG + Intronic
977898822 4:102395406-102395428 CACCATGGCCACTTTGTTCATGG - Intronic
977930292 4:102742998-102743020 CACCATGGCCACTTTGTTCATGG + Intronic
978898954 4:113925992-113926014 CACCATGGCCACTTTGTTCATGG + Intronic
980405776 4:132352969-132352991 CACTATGGCCACTTTGTTCATGG + Intergenic
982847892 4:160275121-160275143 CACCATGGCCACTTTGTTCATGG - Intergenic
983027516 4:162756109-162756131 CACCATGGCCACTTTGTTCATGG - Intergenic
985618499 5:938847-938869 CACTATGGTCACTTTGATCCAGG + Intergenic
985762263 5:1755574-1755596 CACACCGGACTCTTAGAACACGG + Intergenic
985832442 5:2244126-2244148 CACAAAGGCCACTTTGTTCATGG - Intergenic
985963593 5:3322462-3322484 CACACAGCACACTCTGCTCATGG - Intergenic
986036930 5:3949630-3949652 CACCATGGCCACTTTGTTCATGG + Intergenic
986142341 5:5042793-5042815 CAGACTGGTCACTTTTCTCAAGG - Intergenic
986531288 5:8739502-8739524 CACCATGGCCACTTTGTTCATGG + Intergenic
986743066 5:10720579-10720601 CACCATGGCCACTTTGTTCATGG - Intronic
987153299 5:15062488-15062510 CACCATGGCCACTTTGTTCATGG - Intergenic
987173811 5:15286449-15286471 AGCCCTGGACACTTTGAACAGGG + Intergenic
987377906 5:17253775-17253797 CAGACTGGAATCTGTGATCAAGG + Intronic
988079716 5:26400607-26400629 CACCATGGCCACTTTGTTCATGG + Intergenic
988107869 5:26773362-26773384 CACCATGGCCACTTTGTTCATGG - Intergenic
988228866 5:28448946-28448968 CACCATGGCCACTTTGTTCATGG - Intergenic
988739805 5:34059174-34059196 CACCCTGTACACCTTGATCTTGG - Intronic
989045041 5:37266465-37266487 CACCATGGCCACTTTGTTCATGG + Intergenic
989457535 5:41660947-41660969 CACTGTGGCCACTTTGTTCATGG + Intergenic
989486268 5:41995539-41995561 CACCATGGCCACTTTGTTCATGG + Intergenic
990468950 5:56095638-56095660 CACACTGGAGACATTGCTCATGG + Intergenic
991013679 5:61910067-61910089 CACCATGGCCACTTTGTTCATGG + Intergenic
991033665 5:62106745-62106767 CACCATGGCCACTTTGTTCATGG - Intergenic
991330626 5:65488865-65488887 CACCATGGCCACTTTGTTCATGG + Intergenic
991613264 5:68469820-68469842 CCCTGTGGACACGTTGATCATGG + Intergenic
991946259 5:71900946-71900968 CACCATGGCCACTTTGTTCATGG - Intergenic
992243070 5:74790673-74790695 CACCATGGCCACTTTGTTCATGG - Intronic
993260061 5:85646819-85646841 CACACTGTCCACTTTTATCTTGG + Intergenic
993319931 5:86459400-86459422 CACCATGGCCACTTTGTTCATGG - Intergenic
993689711 5:90984839-90984861 TCCACTGGACACTGAGATCAAGG + Intronic
994291254 5:98031133-98031155 CACCATGGCCACTTTGTTCATGG + Intergenic
994917055 5:105994298-105994320 CACCATGGCCACTTTGTTCATGG - Intergenic
995427621 5:112042929-112042951 CACCATGGCCACTTTGATCATGG + Intergenic
995776168 5:115726879-115726901 CACCATGGCCACTTTGTTCATGG + Intergenic
995932644 5:117467385-117467407 AACACTGGACACTTACATTATGG - Intergenic
996164852 5:120211695-120211717 CACCATGGCCACTTTGTTCATGG + Intergenic
996392091 5:122972969-122972991 CACCATGGCCACTTTGTTCATGG + Intronic
996524035 5:124458520-124458542 CACATTGGGCATTTTGATCTTGG - Intergenic
998290218 5:140907732-140907754 CACCATGGCCACTTTGTTCATGG + Intronic
999351488 5:150875653-150875675 CACCATGGCCACTTTGTTCATGG - Intronic
999810198 5:155120260-155120282 CAAAGAGGACACTTTAATCATGG - Intergenic
1000417083 5:160994722-160994744 CACCATGGCCACTTTGTTCATGG - Intergenic
1002998085 6:2305581-2305603 CACCATGGCCACTTTGTTCATGG - Intergenic
1003400856 6:5789661-5789683 CAAACCTGACACTTTGATCCTGG - Intergenic
1003460672 6:6324991-6325013 CACACTGTGCTCTTTCATCATGG + Intergenic
1003791342 6:9550868-9550890 CACTATGGCCACTTTGTTCATGG - Intergenic
1005185291 6:23157886-23157908 CACTGTGGCCACTTTGTTCATGG - Intergenic
1007679384 6:43624038-43624060 CACACTGGACAATGTGAAGATGG + Exonic
1008340376 6:50357100-50357122 CACCATGGCCACTTTGTTCATGG - Intergenic
1009389996 6:63134253-63134275 CACCATGGCCACTTTGTTCATGG + Intergenic
1012091284 6:94901401-94901423 CACATTGGAAATTTTGAACATGG - Intergenic
1012252325 6:96992400-96992422 CCAAGTGGACACTTTCATCAAGG - Intronic
1012920668 6:105218721-105218743 CACCATGGCCACTTTTATCATGG + Intergenic
1013406786 6:109850622-109850644 CACCATGGCCACTTTGTTCATGG - Intergenic
1013675510 6:112457041-112457063 TACACTGGACATTTTTCTCAAGG - Intergenic
1014363288 6:120507531-120507553 CACCATGGCCACTTTGTTCATGG + Intergenic
1014417104 6:121196210-121196232 CACAGTGGCCACTTTGTTCATGG - Intronic
1014631755 6:123797614-123797636 CACCATGGCCACTTTGTTCATGG - Intergenic
1015443174 6:133271741-133271763 CACCATGGCCACTTTGTTCATGG + Intronic
1016144410 6:140650226-140650248 CACCATGGCCACTTTGTTCATGG - Intergenic
1016147212 6:140691893-140691915 CACCATGGCCACTTTGTTCAAGG + Intergenic
1016419496 6:143869848-143869870 CACCATGGCCACTTTGTTCATGG + Intronic
1016576149 6:145571767-145571789 CACCATGGCCACTTTGTTCATGG + Intronic
1016887891 6:148975492-148975514 CACACTGGACACTTTGATCATGG - Intronic
1017187478 6:151616741-151616763 CTCACCAGACACTTTGATCTTGG - Intronic
1018109487 6:160520945-160520967 CCCATTGGGCACTTTGATCCTGG + Intergenic
1018629272 6:165808193-165808215 CACCCTGGACAATTTGCTGAGGG + Intronic
1021120863 7:16794049-16794071 CACACTGGAAACATTGCTAATGG + Intronic
1021988928 7:26123742-26123764 CACCATGGCCACTTTGTTCATGG - Intergenic
1022079001 7:27001151-27001173 CACCATGGCCACTTTGTTCATGG - Intergenic
1022364420 7:29697688-29697710 CACACAGAACACTTTTTTCATGG - Intergenic
1022696939 7:32716050-32716072 CACACAGAACACTTTTTTCATGG + Intergenic
1024040655 7:45550967-45550989 CACCATGGCCACTTTGTTCATGG - Intergenic
1024543099 7:50495170-50495192 CTCACTGGAAACTTTTATCTAGG - Intronic
1024814571 7:53254073-53254095 CCCAGTGGACACACTGATCATGG - Intergenic
1025552225 7:62265160-62265182 CAAACTGCAAACTTTCATCAGGG + Intergenic
1025780700 7:64599445-64599467 CACAATGGCCACTATGAGCAGGG - Intergenic
1027406944 7:77872185-77872207 CACCATGGCCACTTTGTTCATGG + Intronic
1027558444 7:79695842-79695864 AACACTGGAGACATTGATTATGG + Intergenic
1027685910 7:81278775-81278797 CACCATGGCCACTTTGCTCATGG - Intergenic
1028935128 7:96455885-96455907 CACCATGGCCACTTTGTTCATGG - Intergenic
1029829390 7:103239899-103239921 CACACAGAACACTTTTTTCATGG + Intergenic
1030277661 7:107737460-107737482 CACCATGGCCACTTTGTTCATGG - Intergenic
1030457347 7:109792225-109792247 CACCATGGCCACTTTGTTCATGG + Intergenic
1030748656 7:113201622-113201644 CACACTGGCTACTCTGATTAGGG + Intergenic
1031202301 7:118703619-118703641 CAAAATGGCCACTTTGTTCATGG - Intergenic
1031833119 7:126650836-126650858 CACAATGGCCACTTTGTTTATGG - Intronic
1032152989 7:129446139-129446161 CACAGTGGCCACTTTGCTCATGG + Intronic
1032694182 7:134319640-134319662 GACACTGGAAATTTTGATTAAGG - Intergenic
1033076375 7:138253867-138253889 CACCGTGGCCACTTTGTTCATGG - Intergenic
1034169921 7:149055091-149055113 CACCATGGCCACTTTGTTCATGG - Intergenic
1034269872 7:149798273-149798295 GACACTGGTCACTTTGGACATGG + Intergenic
1036105787 8:5837125-5837147 GACAATGGACACTGTTATCAGGG + Intergenic
1037364472 8:18107442-18107464 CACTGTGGCCACTTTGTTCATGG + Intergenic
1037936732 8:22919962-22919984 CAGACTGGAAACTTTGGTGATGG - Intronic
1038219136 8:25591135-25591157 CACACTGTACACTCTGAGCTTGG + Intergenic
1039434220 8:37548484-37548506 CATGCTGGATCCTTTGATCAGGG - Intergenic
1040912055 8:52529236-52529258 CACCATGGCCACTTTGTTCATGG - Intergenic
1042028004 8:64444387-64444409 CACACTAGAGGCTTTAATCATGG + Intergenic
1042938910 8:74088270-74088292 CACACTGGACACTTCTTGCAGGG + Intergenic
1043356736 8:79422615-79422637 CATACTGAACATTTTCATCAAGG - Intergenic
1044150909 8:88773891-88773913 CACCATGGCCACTTTGTTCATGG - Intergenic
1044166944 8:88996599-88996621 CACACTGCTCACTTTGCACAAGG - Intergenic
1044285861 8:90411625-90411647 CACCATGGCCACTTTGTTCATGG + Intergenic
1044760967 8:95517146-95517168 CACACTGGACATTGTCATCCTGG + Intergenic
1044895954 8:96891497-96891519 CACCATGGCCACTTTGTTCATGG + Intronic
1046128559 8:109940776-109940798 CACCATGGACACTTTGTTCATGG + Intergenic
1046417534 8:113936973-113936995 CACCATGGCCACTTTGTTCACGG + Intergenic
1050045500 9:1540156-1540178 CAAACTGGCCACTTAAATCAAGG + Intergenic
1052442153 9:28511469-28511491 CACCATGGCCACTTTGTTCACGG + Intronic
1052737227 9:32354757-32354779 CACCATGGCCACTTTGCTCATGG + Intergenic
1053695848 9:40638684-40638706 CACCATGGCCACTATGATCATGG + Intergenic
1054307095 9:63437902-63437924 CACCATGGCCACTATGATCATGG + Intergenic
1055903825 9:81270373-81270395 CACCATGGTCACTTTGTTCATGG + Intergenic
1056156789 9:83846025-83846047 CACCATGGCCACTTTGTTCATGG - Intronic
1056353747 9:85777501-85777523 CACCATGGCCACTTTGTTCATGG + Intergenic
1058020017 9:100076881-100076903 CACCATGGCCACTTTGTTCATGG - Intronic
1058179786 9:101783024-101783046 CACAGTGGAAACGTTAATCAAGG - Intergenic
1058259150 9:102808866-102808888 CACCATGGGCACTTTGTTCATGG + Intergenic
1059196390 9:112375042-112375064 CACCATGGCCACTTTGTTCACGG + Intergenic
1062135592 9:134925828-134925850 CATAATGGCCACTTTGTTCATGG - Intergenic
1202778293 9_KI270717v1_random:12296-12318 CACCATGGCCACTATGATCATGG + Intergenic
1203429565 Un_GL000195v1:79158-79180 CACACTGGACACCTGTTTCATGG + Intergenic
1203436729 Un_GL000195v1:144153-144175 CACACTGGACACCTGTTTCATGG - Intergenic
1186336999 X:8599880-8599902 CCCACTAGAGACTTTGATAATGG - Intronic
1186469654 X:9811316-9811338 CACCATGGCCACTTTGTTCATGG + Intronic
1187524033 X:20037946-20037968 CACCGTGGCCACTTTGTTCATGG - Intronic
1187552271 X:20317903-20317925 CCCAAGGAACACTTTGATCAGGG + Intergenic
1190383079 X:49858213-49858235 CTCACTGCACACTTTGGCCAAGG + Intergenic
1191658684 X:63628989-63629011 CACCATGGCCACTTTGTTCATGG + Intergenic
1191769387 X:64739279-64739301 CACCATGGCCACTTTGTTCATGG + Intergenic
1192297601 X:69867209-69867231 CACCATGGCCACTTTGTTCATGG + Intronic
1193883764 X:86960149-86960171 CACACTGGCAACTTTGTACATGG + Intergenic
1193904588 X:87226637-87226659 CACCATGGCCACTTTGTTCATGG - Intergenic
1194485217 X:94478144-94478166 CACAATGGCCACTTTGTTCATGG - Intergenic
1194513313 X:94821431-94821453 CACCATGGACATTTTGTTCATGG + Intergenic
1194849134 X:98851348-98851370 CACCATGGCCACTTTGTTCATGG + Intergenic
1195302733 X:103547188-103547210 CACATTGGATAATTTGACCAAGG + Intergenic
1195748408 X:108141252-108141274 CACCATGGCCACTTTGTTCATGG + Intronic
1195748818 X:108144543-108144565 CACCATGGCCACTTTGTTCATGG + Intronic
1195809679 X:108816030-108816052 CACCATGGCCACTTTGTTCATGG + Intergenic
1196135854 X:112209023-112209045 CACCGTGGCCACTTTGTTCATGG + Intergenic
1197182209 X:123548600-123548622 CACCATGGCCACTTTGTTCATGG - Intergenic
1197386667 X:125811424-125811446 CACCATGGCCACTTTGTTCATGG + Intergenic
1197477253 X:126940613-126940635 CACCATGGCCACTTTGTTCATGG + Intergenic
1198782926 X:140256992-140257014 CACCATGGCCACTTTGCTCATGG + Intergenic
1198934152 X:141888675-141888697 CACTATGGCCACTTTGTTCATGG - Intronic
1199024496 X:142920543-142920565 CACCATGGCCACTTTGTTCATGG - Intergenic
1199310315 X:146313583-146313605 CACCATGGCCACTTTGTTCATGG + Intergenic
1199310833 X:146317889-146317911 GAGACTGGACACTTTGAACCCGG + Intergenic
1200745944 Y:6904052-6904074 CACCATGGTCACTTTGTTCATGG + Intergenic
1201145530 Y:11063215-11063237 CTCACTGGACCCTTGGCTCAAGG - Intergenic
1201796557 Y:17902818-17902840 CACCATGGCCACTTTGTTCATGG + Intergenic
1201804998 Y:18003167-18003189 CACCATGGCCACTTTGTTCATGG - Intergenic