ID: 1016889576

View in Genome Browser
Species Human (GRCh38)
Location 6:148992590-148992612
Sequence TCATGCAAATAGAGTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016889576_1016889579 -9 Left 1016889576 6:148992590-148992612 CCCAGAGGACTCTATTTGCATGA 0: 1
1: 1
2: 1
3: 15
4: 158
Right 1016889579 6:148992604-148992626 TTTGCATGAAAACTTGGTTGTGG 0: 1
1: 0
2: 1
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016889576 Original CRISPR TCATGCAAATAGAGTCCTCT GGG (reversed) Intronic
904955931 1:34283885-34283907 TCATGCAAACAAAGTCATCCTGG - Intergenic
908070475 1:60454748-60454770 TCATGCCACTACAGCCCTCTGGG - Intergenic
909688310 1:78376041-78376063 TCTTGAAAATAGAATCCTTTAGG - Intronic
910706422 1:90134290-90134312 CCAGGCAAAGAGAATCCTCTGGG - Intergenic
911261473 1:95691520-95691542 ACATGCAAACACAGTCGTCTAGG + Intergenic
912158135 1:106947578-106947600 TTATGCAAATAGAATCCTTAGGG + Intergenic
913984456 1:143552395-143552417 TGATGCAGATGGATTCCTCTAGG - Intergenic
915118728 1:153615648-153615670 TGATGCAGATGGAGTCCTCCTGG - Intronic
915614076 1:157021770-157021792 TTTTGCAAATAGAGTCTTATTGG - Intronic
917341073 1:173978245-173978267 TCAGGAAAATAGATTTCTCTGGG - Intronic
917771473 1:178284205-178284227 TCATGCAGCTACAGTTCTCTAGG - Intronic
917935988 1:179867694-179867716 TCCTACCAATAGAGTCCTCTGGG - Intronic
918326426 1:183415472-183415494 TCATGAAAATAGAGTGTTCATGG + Intronic
922914775 1:229248207-229248229 TCATGCGAGCAGAGTCCTCACGG + Intergenic
1063615967 10:7600762-7600784 TCATGAAATTAGAGCCCTCATGG + Intronic
1068293293 10:55033359-55033381 CCATGCTAATAGGGTCCTCTGGG + Intronic
1070189987 10:74103225-74103247 TAATCCAAATAGAGTCCATTAGG - Intronic
1070616989 10:77976852-77976874 TTAAGCAAATAGAGCCGTCTGGG - Exonic
1071917303 10:90308800-90308822 TCTTGCAAAAAGAATCCTTTAGG + Intergenic
1073271467 10:102268042-102268064 TCATCAAAATATAGGCCTCTTGG - Intronic
1074059074 10:109948496-109948518 TCATGATATAAGAGTCCTCTTGG - Intronic
1078041807 11:7871309-7871331 CCATGCATTTAGAGTGCTCTAGG + Intergenic
1078632580 11:13016575-13016597 CCATGCAAATGGTGCCCTCTGGG - Intergenic
1079481061 11:20880729-20880751 TCATTTAAATAGAGTCCAGTTGG + Intronic
1081053001 11:38368940-38368962 TCATGCACATTCACTCCTCTGGG + Intergenic
1082611888 11:55310170-55310192 GCATGGAAATAGTGTCCTTTTGG + Intergenic
1082687975 11:56262745-56262767 TCATGCCAACAGGGTCCTATAGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1085288534 11:75380387-75380409 TCCTGCAAATACATTCCTATAGG - Intergenic
1085943221 11:81231242-81231264 TCATTGAAATAGATTCTTCTGGG - Intergenic
1086157006 11:83678537-83678559 TCATGCAAATAGAAGGCTCTTGG + Intronic
1089836514 11:121375304-121375326 TCATGCAGATAAAGTCCCCCAGG - Intergenic
1090347407 11:126082595-126082617 TCATGCAAATAGAGCCCTCTTGG - Intergenic
1092296696 12:7205674-7205696 TGATGGAAAAAGAGTACTCTGGG - Intronic
1094304133 12:28998702-28998724 TAATGCAAATGCAGTGCTCTAGG + Intergenic
1094304599 12:29004000-29004022 TCCTGCAATAAGAGTCCTCAGGG + Intergenic
1094785108 12:33839095-33839117 TCATAGTAATAGAGTCTTCTAGG - Intergenic
1101219317 12:102620214-102620236 TAATGGAAATATAGTCTTCTAGG - Intergenic
1104135073 12:125930092-125930114 TCATCCAACCAGAGTCCTCTAGG - Intergenic
1105825208 13:24116296-24116318 TCATGAAAGCAGAGTCCTCATGG - Intronic
1107542477 13:41403947-41403969 TCATGAAGGTAGAGCCCTCTTGG - Intergenic
1107864680 13:44692230-44692252 TCATGCAAATAATGTCTTATAGG - Intergenic
1111164369 13:84438911-84438933 TCATCTCAATAGAGTCATCTAGG - Intergenic
1111318841 13:86596914-86596936 TCATGCAAATAGAATCATACAGG - Intergenic
1111474684 13:88728661-88728683 TCATGCAAATACAGTTCACAGGG - Intergenic
1111718676 13:91913559-91913581 TGATGTAAATAGAGACCTGTGGG + Intronic
1115398864 14:32937365-32937387 TCAAGCAAAGAGTGGCCTCTTGG + Intronic
1117289600 14:54319803-54319825 TCATTTTAATAGAGCCCTCTAGG - Intergenic
1118565173 14:67131771-67131793 TTATCCAAATAGAATCCACTTGG + Intronic
1119089232 14:71765168-71765190 AAATGAAACTAGAGTCCTCTGGG + Intergenic
1119348485 14:73945010-73945032 TCATGGACATAGAGGCCTGTGGG - Intronic
1119975347 14:79018476-79018498 AGATGCAAATTAAGTCCTCTAGG - Intronic
1124582065 15:30965545-30965567 TGATGAAAACAGAGTCCTCATGG + Intronic
1130757650 15:86783055-86783077 TCATGGATATGGATTCCTCTGGG - Intronic
1130899120 15:88193596-88193618 TTATGCAAATAGTGACCACTAGG + Intronic
1131333268 15:91522493-91522515 TCGTGCAGATAAAGTTCTCTGGG + Intergenic
1131687983 15:94791993-94792015 TCATGCAAATATAGTGACCTGGG + Intergenic
1136869982 16:33798108-33798130 ACATGCAAATAGGGCCCTCCAGG + Intergenic
1138628581 16:58274371-58274393 TGTTCCAAATAGAGTCCCCTTGG + Intronic
1140630593 16:76847470-76847492 TTATGTAAATTGAGTCTTCTTGG + Intergenic
1140730359 16:77850755-77850777 CCATGCAAATACAGTCATCCAGG + Intronic
1142115842 16:88355709-88355731 TCTTGCAGGGAGAGTCCTCTGGG + Intergenic
1203102189 16_KI270728v1_random:1317946-1317968 ACATGCAAATAGGGCCCTCCAGG - Intergenic
1156839778 18:41597752-41597774 TCATTCAAATAGAGCCTTGTAGG - Intergenic
1157120307 18:44903505-44903527 TCATCCCCATAGAGTCATCTTGG - Intronic
1158695914 18:59703747-59703769 TAATGAAAATAGAGGCCTGTGGG + Intergenic
1159470945 18:68855116-68855138 TTATGCAAATAAATTACTCTTGG - Intronic
1160023309 18:75198068-75198090 TCATGCTAATTGAGAACTCTGGG + Exonic
1161425852 19:4202731-4202753 TCATGAAAATGGAGTCCCTTGGG + Intronic
1165529659 19:36387381-36387403 TCATGAAAGCAGAGTCCTCATGG - Intronic
1166016641 19:39985111-39985133 TAATGTTAATAAAGTCCTCTTGG + Intronic
1168053654 19:53848575-53848597 TGAAGAAAATAAAGTCCTCTAGG - Intergenic
928700768 2:33896425-33896447 TCATGCAAATTGAGTGCTCAAGG + Intergenic
929058883 2:37903242-37903264 TTATGCAGATAAAGTCCTCCAGG + Intergenic
929780890 2:44956154-44956176 TCTTGCAGATAGATGCCTCTAGG + Intergenic
929812257 2:45200682-45200704 TCATGCCACTGCAGTCCTCTGGG - Intergenic
931807652 2:65823305-65823327 TCATGGAATCAGAGTCTTCTGGG + Intergenic
933988551 2:87615540-87615562 TCATGTAAATGGAGTCATCAGGG - Intergenic
936305289 2:111335271-111335293 TCATGTAAATGGAGTCATCAGGG + Intergenic
937986095 2:127638797-127638819 CCATGCAGATGGAGGCCTCTGGG - Exonic
938324245 2:130387426-130387448 TCATGCAAATAGCCTCTTCCCGG + Intergenic
939572407 2:143856225-143856247 TCATGCAAAGACAGACCACTCGG - Intergenic
942818167 2:180077122-180077144 ACATGCTAATAGAGTCCATTTGG - Intergenic
943148504 2:184078069-184078091 TTAGGAAAATATAGTCCTCTGGG - Intergenic
944412495 2:199458001-199458023 TCAGGCAAAGTGAGTCCTTTTGG + Exonic
947790186 2:232861862-232861884 TCATGGGAAAAGAGTCCTCGTGG + Intronic
1169558767 20:6776305-6776327 TCAGGCCAATAGAGTCCTTTAGG - Intronic
1169866069 20:10201522-10201544 TCCTGCAACTATAGTCATCTGGG + Intergenic
1173418809 20:42882341-42882363 TCATGCTAATACAATCTTCTGGG - Intronic
1174237063 20:49102776-49102798 TCATGGAAAAGGAGACCTCTTGG + Intergenic
1176037546 20:63047212-63047234 GCATGCCAGTAGCGTCCTCTTGG - Intergenic
1177253680 21:18630892-18630914 TCATTAAAATAGAGTCATTTTGG - Intergenic
1177342426 21:19822118-19822140 CCAGGCAAATATAGTACTCTTGG - Intergenic
1180074114 21:45454069-45454091 TCAAGCAAAGAGACTTCTCTGGG + Intronic
1181470485 22:23136244-23136266 TCATGCAAATTAACTCCTCAAGG + Intronic
1181470660 22:23137375-23137397 TCATGCAAATTAACTCCTCAAGG + Intronic
949589299 3:5476592-5476614 TCCTGGAAATAGTGGCCTCTAGG + Intergenic
949908910 3:8883952-8883974 TCTTGCAAGTAGAGTCTTCCAGG + Intronic
949908915 3:8884015-8884037 TCTTGCAAGTAGAGTCTTCCAGG + Intronic
949909283 3:8887707-8887729 TCTTGCAAGTAGAGTCTTCAGGG + Intronic
950140936 3:10614742-10614764 TCAACCAAATAAAGTCCTGTGGG - Intronic
951299778 3:20981465-20981487 TCATGGAAATAGAGTTTTCTGGG - Intergenic
951521246 3:23612438-23612460 CCCTGCCAATGGAGTCCTCTGGG - Intergenic
952108289 3:30093573-30093595 TCATGCAAAAGGAATGCTCTCGG + Intergenic
952510380 3:34047688-34047710 TCATGAAAATAGAGCCCTGATGG - Intergenic
952538127 3:34335614-34335636 TCATACAATCAGAGTGCTCTGGG + Intergenic
953261159 3:41340317-41340339 TAATGCAAATACAGGCCTCTAGG + Intronic
954391775 3:50271316-50271338 TCAGGCAAATGGAGGGCTCTTGG - Intronic
964408459 3:156374418-156374440 CCAAGCAAATAAAGTGCTCTAGG - Intronic
968136331 3:196222316-196222338 TCATGGAAACAGAGTTCTGTAGG + Intronic
971381486 4:26102825-26102847 TCATGCAAACAGATTCCACAGGG - Intergenic
971408239 4:26342304-26342326 TAATGCAACTAGAGACCTCCTGG - Intronic
974225816 4:59042227-59042249 TCAAGAAAATAGAGTCACCTTGG - Intergenic
974966393 4:68765760-68765782 TAATGCAAAGAGAATCCACTTGG - Intergenic
975992270 4:80268807-80268829 ATATGGAAATAGATTCCTCTCGG - Intronic
977095354 4:92735705-92735727 TCATGCAAATAAAATTTTCTAGG - Intronic
979174003 4:117638631-117638653 TTATGAAAATAGGGTCCTTTTGG + Intergenic
979893238 4:126126782-126126804 ACATGCAAATAGAATCATGTTGG - Intergenic
980568291 4:134574860-134574882 TCATCCATATAGAGTCTTCAAGG - Intergenic
981896124 4:149802169-149802191 TCATGCAAAACTAGTCCCCTAGG + Intergenic
983809663 4:172044801-172044823 TCATGCAAACAAAGTTTTCTGGG - Intronic
987453071 5:18110319-18110341 TCATGCATATATAGTCAACTTGG - Intergenic
989312897 5:40041428-40041450 TCATGCAATGAAAGTCCTTTGGG - Intergenic
991204009 5:64029021-64029043 TAATGCAAATAGCATCCTCACGG + Intergenic
993176039 5:84486976-84486998 TCATGCAAAAATAGTGTTCTGGG - Intergenic
994119402 5:96096903-96096925 TCTTGCCAATAGACTCCTGTTGG + Intergenic
995596149 5:113750095-113750117 TCCTTAAAATGGAGTCCTCTCGG - Intergenic
996806039 5:127455040-127455062 TCATGATAATAGAGCCCTCTTGG + Intronic
998072472 5:139208848-139208870 ACATGCAAATGAAGCCCTCTTGG + Intronic
998337453 5:141385348-141385370 TCATGCAAATAAATTCCTCATGG - Intronic
998770248 5:145535588-145535610 TCAAGGAAAATGAGTCCTCTAGG + Intronic
999034555 5:148333114-148333136 TCATGCTCATGGAGTCCTCTTGG - Intronic
1000507648 5:162141532-162141554 TCATGCAGATAAAGTCCAGTAGG + Intronic
1000705111 5:164501417-164501439 TCATGCAAATGTAGCACTCTGGG - Intergenic
1003660320 6:8054674-8054696 TTATAGAAAAAGAGTCCTCTGGG - Intronic
1005892071 6:30148132-30148154 TCATTCAAATAGGATCCTCCAGG + Exonic
1008260795 6:49364681-49364703 TCATTGAAAAAGAGTCATCTAGG - Intergenic
1009360859 6:62810889-62810911 TCATGCGAGGAGAGTCCTCCAGG + Intergenic
1010415909 6:75611212-75611234 TCATTCAAATAGTGACCACTGGG - Intronic
1011213443 6:84978888-84978910 TCATTGAACTAGAGTACTCTAGG - Intergenic
1011927855 6:92670674-92670696 TCATGAAAATAGAGCCCTCCTGG - Intergenic
1012612630 6:101234598-101234620 TGAGGAAACTAGAGTCCTCTTGG + Intergenic
1014235695 6:118951805-118951827 TCATGGAGATAGAGTTTTCTTGG + Intergenic
1014501113 6:122190518-122190540 TCATTCAAATAGAGTATGCTTGG + Intergenic
1016688203 6:146905397-146905419 TTTTGCAACTGGAGTCCTCTGGG - Intergenic
1016889576 6:148992590-148992612 TCATGCAAATAGAGTCCTCTGGG - Intronic
1025101008 7:56135067-56135089 TTATGCAAATAGACTCCTCAAGG - Intergenic
1025223231 7:57134150-57134172 TCATGGAAATGCAGTCCTGTAGG - Intronic
1025634036 7:63305817-63305839 TCATGGAAATGCAGTCCTGTAGG - Intergenic
1025648661 7:63442350-63442372 TCATGGAAATGCAGTCCTGTAGG + Intergenic
1025746472 7:64247274-64247296 TCATGGAAATGCAGTCCTGTAGG + Intronic
1026649653 7:72204299-72204321 ACATTAAAAAAGAGTCCTCTTGG - Intronic
1026707464 7:72707317-72707339 TCATGTGAATAGAGGCCCCTGGG + Intronic
1028857582 7:95608984-95609006 TCATGGAAATAGAGCTCACTAGG + Intergenic
1030097524 7:105913869-105913891 TCCTGCAAACAGAGTCCTCTGGG - Intronic
1033561660 7:142537743-142537765 TCAAGGAAACAGAATCCTCTAGG + Intergenic
1034439453 7:151079278-151079300 TCCTGCTAATAGAGTGCCCTAGG - Intronic
1038269751 8:26065585-26065607 TCATGAACAGAGTGTCCTCTGGG + Intergenic
1040657395 8:49527551-49527573 TCATGAAAACAGAGCCCTCATGG + Intergenic
1040885193 8:52255190-52255212 TCATGGAAATAGAGCACTCCGGG - Intronic
1041733485 8:61086291-61086313 TTATGCAAATTGAGTCTCCTAGG - Intronic
1042441086 8:68827759-68827781 TAATGCATATAGAGTACTCAGGG - Intergenic
1043103756 8:76082363-76082385 TCATGAGAACAGAGTCCTCTTGG + Intergenic
1045722370 8:105128695-105128717 TCATGCAAATTTAGTCCTAAAGG + Intronic
1047528180 8:125651606-125651628 TTATGCAAATAGATTCTTATAGG + Intergenic
1048668581 8:136691679-136691701 TCATGCAAATGAGGTCCTGTTGG + Intergenic
1054904131 9:70400080-70400102 TTATACAAATAAGGTCCTCTTGG + Intronic
1056955435 9:91077311-91077333 TCATGAAAGCAGAGTCCTCATGG + Intergenic
1058109594 9:101017825-101017847 TCATGAAAATGGAGCCCTCATGG - Intergenic
1058586627 9:106513954-106513976 TCATGGGAAAGGAGTCCTCTTGG + Intergenic
1061722015 9:132557680-132557702 CCATGCAAATCGAGGCCACTTGG + Intronic
1186803775 X:13119101-13119123 TCATGCAAATAGATTGCTGATGG - Intergenic
1194722471 X:97356340-97356362 TCATGCAAATAGAGCCCTAAGGG + Intronic
1197304919 X:124830065-124830087 TAATGCAAATAAACTCCCCTGGG - Intronic
1197987576 X:132283294-132283316 ACATGCAAGTACAGTTCTCTGGG - Intergenic
1199461184 X:148087274-148087296 TCATGAGAATGGAGTCCTCATGG + Intergenic