ID: 1016890039

View in Genome Browser
Species Human (GRCh38)
Location 6:148996554-148996576
Sequence CAAGAGAAAGAGTCTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016890039_1016890041 18 Left 1016890039 6:148996554-148996576 CCTCCTACAGACTCTTTCTCTTG 0: 1
1: 0
2: 3
3: 27
4: 315
Right 1016890041 6:148996595-148996617 ATAGTTCTACATTTACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016890039 Original CRISPR CAAGAGAAAGAGTCTGTAGG AGG (reversed) Intronic
900297571 1:1959646-1959668 CAGGGGAAAGAGTCAGTAGAGGG + Intronic
901013492 1:6214016-6214038 CTTGAGAAAGAGTGTGAAGGAGG + Intronic
902064904 1:13676934-13676956 TAAGAGAAGGAGTTTGTTGGAGG + Intergenic
902907725 1:19571070-19571092 AAAGAGGTAGAGTCTTTAGGAGG + Intergenic
902991536 1:20190921-20190943 CAACAGAAAGAACCTGGAGGAGG + Exonic
903974817 1:27142532-27142554 CAAGAGAAAGCCTCTGAAGGTGG - Intronic
907521895 1:55029321-55029343 CAAGGGCAAGAGTATGCAGGTGG - Intergenic
907686877 1:56620440-56620462 ATTGAGAAAGAGACTGTAGGAGG + Intronic
908865670 1:68546746-68546768 CAAGAGAAAGAGTGGGGTGGGGG + Intergenic
909151044 1:72005429-72005451 CAAGAGAAAGAATATATAGATGG - Intronic
909327187 1:74365417-74365439 CAATTGAAAAAGTCTGTAGTAGG - Intronic
910629236 1:89339349-89339371 CAAGAGAGAGAAACTGGAGGGGG - Intergenic
911590838 1:99745885-99745907 CAAGAGAGAGAGTTAGTGGGGGG - Intronic
911674633 1:100645958-100645980 CAAGAGGTAAAGTCTGTTGGGGG + Intergenic
912307376 1:108582973-108582995 CAGGAGAAAGTGTGTGTGGGGGG - Intronic
914922500 1:151856951-151856973 AAATATAAAGAGTCAGTAGGTGG + Intergenic
915996723 1:160571372-160571394 GAGGAGAAAGAGTCTCAAGGAGG + Intronic
916149292 1:161770612-161770634 CGAGAGATACAGTCTTTAGGAGG - Intronic
917205237 1:172564464-172564486 CAGGAGAAAGAGAGTGAAGGGGG - Intronic
917301001 1:173574167-173574189 CAAGAGAGAGAGTCTAGAGGAGG - Intronic
917663106 1:177196992-177197014 CTAGAGATAGAGTCTTTAGGAGG + Intronic
918461126 1:184777762-184777784 CAAGAGAAAGTTTCTATATGTGG + Intergenic
918884455 1:190173288-190173310 CAAAAGCAAGAATCTGTACGTGG + Intronic
919422327 1:197385478-197385500 GAGGAGAAAGACTCTGGAGGAGG - Intronic
920267734 1:204736955-204736977 CAAGAGAACCAGACTGTAGCAGG + Intergenic
920742990 1:208598887-208598909 CAAGAAAAAAAATCTGTTGGGGG + Intergenic
921601753 1:217113568-217113590 CAATAGAAAGAGACTTTTGGGGG + Intronic
921603965 1:217135455-217135477 CAAGAGAAAGCGTGTGGAGCTGG + Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922013363 1:221615555-221615577 CAAGAGCAAGAGCATGAAGGGGG - Intergenic
922460028 1:225808856-225808878 CAAGAGAAAGCTTTTATAGGAGG + Intergenic
922460043 1:225808946-225808968 CAAGAGCAAAAGTTTGGAGGTGG + Intergenic
922703960 1:227779211-227779233 CATGAGAAACAGTATGAAGGCGG - Intronic
923188465 1:231596795-231596817 GAAGAGAAAGACTCTGAATGAGG + Intronic
1064608521 10:17071519-17071541 CTGGAGAAAGAACCTGTAGGTGG - Exonic
1064862911 10:19846946-19846968 CAAGAGAGAGCGTGTGCAGGTGG + Intronic
1065108510 10:22415494-22415516 CAAGAGTAAGAGGCTGTTAGGGG + Intronic
1065148288 10:22795440-22795462 CAAGAGAAAGAGAGTGAGGGAGG - Intergenic
1066230561 10:33428805-33428827 AAAGAGAAAGAGGTTGTAGGAGG - Intergenic
1066235851 10:33483733-33483755 CAACAGAATGAGTCTATTGGTGG - Intergenic
1067743038 10:48910966-48910988 AAAGAAAAAGTGTCTGAAGGGGG + Intronic
1068491773 10:57733533-57733555 TAAGAGAGAAAGACTGTAGGTGG - Intergenic
1068693397 10:59941058-59941080 CAAGAGAAAGAGTGCGTGGTGGG + Intergenic
1071676501 10:87660151-87660173 CAAGAGAAAGAGGCTCTGTGTGG + Intronic
1071815882 10:89232453-89232475 CAAGAGGAAGGCTCGGTAGGTGG + Intronic
1075028057 10:119001532-119001554 CTACAGAAAGAGTCTCGAGGTGG + Intergenic
1075303977 10:121351122-121351144 CAAGAGAAAGAGCTTGTGTGGGG - Intergenic
1075389606 10:122083176-122083198 CAAGAGAAAGAGGCTGCAGGTGG + Exonic
1076118020 10:127914132-127914154 CAAGAGAGAGAGTGGGTGGGGGG - Intronic
1077792432 11:5455748-5455770 CAAGAGAGAGAGTCAGAAAGAGG + Intronic
1078375651 11:10791179-10791201 CGAGAGAGAGAGTGTGAAGGAGG - Intergenic
1078922339 11:15842334-15842356 AAAGAGAAAGAGTTTGGGGGTGG + Intergenic
1079893990 11:26095517-26095539 GAAGAGAAAGAGACGGAAGGGGG + Intergenic
1080427730 11:32171764-32171786 CTAGAGAAATAGTGAGTAGGAGG + Intergenic
1080650511 11:34219152-34219174 CTAGAGGAGGAGTCTGTAGTAGG + Intronic
1080919448 11:36694432-36694454 CAAGGGAGAGAGTCTGGTGGTGG - Intergenic
1081380425 11:42407826-42407848 AAAGAGCCATAGTCTGTAGGTGG + Intergenic
1084340839 11:68499464-68499486 CAAGAGAAAGAGCCCCTAAGTGG + Intronic
1084473274 11:69375311-69375333 CTGGAGTAAGAGTCTGCAGGGGG - Intergenic
1084972120 11:72777705-72777727 AAAGAGAAAGGGGCTGTTGGAGG - Intronic
1086774622 11:90814834-90814856 CAAGAGTAAGAGAATGTTGGCGG - Intergenic
1087628437 11:100622846-100622868 CAAGAGAGAGAGAGTGTAGGGGG + Intergenic
1088009403 11:104981104-104981126 CAAGAGAAGCAGTGTGTATGGGG - Intergenic
1089122709 11:116148879-116148901 CAAGAGTATGAGGCTGCAGGTGG - Intergenic
1089456989 11:118631498-118631520 CAAGACAAAGAGGCTGAAGTTGG + Intronic
1089500935 11:118930748-118930770 TAATAGAGAGGGTCTGTAGGAGG + Intronic
1090238780 11:125167173-125167195 CTAGAGAAAGAGTGTGTGTGGGG + Intronic
1091930045 12:4388789-4388811 CAGGAAAAAGAGTGTGTTGGCGG - Intergenic
1092779755 12:11974620-11974642 CAGGAGATAGGGTCTTTAGGAGG - Intergenic
1093092345 12:14936090-14936112 CAAGAGGAAGAGCCGGTGGGAGG - Intronic
1093281644 12:17203476-17203498 CAAGAGAAAGAGAGAGAAGGTGG - Intergenic
1093886860 12:24471525-24471547 CAAGAGAATGGGTCAGTATGAGG - Intergenic
1094566598 12:31604180-31604202 CAAGAGAAATTGTATGTAGCAGG - Intergenic
1095043880 12:37476956-37476978 TAAGAGAAAAAGTCTTTAGATGG - Intergenic
1096200887 12:49681965-49681987 CAGGAGAAAGACCCTGTAAGTGG + Intronic
1096367102 12:51037310-51037332 CAAGAAAAAGACTCTGAGGGAGG + Intergenic
1097323331 12:58248762-58248784 CAGGAGGAAGAGACTGAAGGGGG + Intergenic
1098287253 12:68920065-68920087 CAAGAGAAAGAGGGGGTGGGAGG - Intronic
1103560769 12:121792367-121792389 CAGGAGAAACAGTCAGTGGGAGG - Intronic
1103610386 12:122120615-122120637 CAAGAAAAAGAGTCAGCAGATGG + Intronic
1104313465 12:127675566-127675588 CAACAGATAGAGTCTGTGGGGGG - Intergenic
1107640116 13:42433447-42433469 CAAGAGACAGAGTGTGAAGATGG - Intergenic
1108981927 13:56524680-56524702 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1109258509 13:60113883-60113905 CTAGGGAAAGAGTTGGTAGGTGG - Intronic
1109466158 13:62734437-62734459 CAAGATAAAAAGTCTTTTGGGGG + Intergenic
1110005071 13:70255735-70255757 CAAGCGAGAGAGACTGTAGCTGG - Intergenic
1111606779 13:90548563-90548585 CAAGAGAGAGAGTTTGTGGAGGG + Intergenic
1111937417 13:94571244-94571266 CAAGAGAGAGAGGCAGTAGCGGG + Intergenic
1112274655 13:98005212-98005234 CAAGAGCAAGACTCTGTCTGGGG - Intronic
1112743096 13:102496680-102496702 CAGGAGAAAGAGTGTGAAGGGGG + Intergenic
1114412792 14:22516517-22516539 CTAGAGCAAGAGTCTGCATGTGG - Intergenic
1114665283 14:24374022-24374044 CCAGAGACAGAGTCTGTGGCAGG - Intronic
1115258554 14:31429242-31429264 CAAGAGGCAGAGGCTGTAGTGGG - Intronic
1116337650 14:43678118-43678140 GAAGAAAAAAAGTCTGTATGTGG + Intergenic
1116625560 14:47258386-47258408 CAAGAGGAAGAGAGTGAAGGGGG + Intronic
1117498062 14:56325624-56325646 GAAGTGCAAGAGTCTGTGGGAGG + Intergenic
1118963766 14:70560713-70560735 CAAGAGAGAGAGAGTGAAGGGGG - Intergenic
1119483730 14:74975224-74975246 GAAGAGATAGAGGCTGGAGGGGG + Intergenic
1119949162 14:78726895-78726917 CAAAAGAAAGATTCTGAAGATGG - Intronic
1120432095 14:84432187-84432209 CAAGAGAATGAGACCGTAGATGG - Intergenic
1121272799 14:92649263-92649285 CCACAGGAAGAGTCTGGAGGTGG + Intronic
1202942417 14_KI270725v1_random:164589-164611 TAAGAGAAAAAGTCTTTAGATGG - Intergenic
1124364411 15:29062050-29062072 CTTGGGAAAGAGCCTGTAGGTGG + Intronic
1126290999 15:47078912-47078934 TAAGAGAAAAAGTCTTTAGATGG + Intergenic
1126887138 15:53163224-53163246 GAAGAGAAAGAGTGAGTTGGGGG + Intergenic
1127555335 15:60082049-60082071 CAATAGAGAGAGGCTGTGGGAGG + Intergenic
1127994104 15:64142551-64142573 CACAGGAAAGAATCTGTAGGTGG + Intronic
1128735084 15:70048922-70048944 GGAGAGGAAGAGACTGTAGGCGG + Exonic
1131268296 15:90931797-90931819 GGAGAGAAAGAGGCTGCAGGTGG - Exonic
1133640672 16:7714272-7714294 CAGAACAAAGAGTCTGCAGGTGG - Intergenic
1133997718 16:10761030-10761052 TGAGAGAGAGAGTGTGTAGGAGG + Intronic
1134267377 16:12703800-12703822 CAAGAGAAACAGTCTGTTCTAGG - Intronic
1134599902 16:15525178-15525200 CAACAGAAAGGGTGAGTAGGAGG + Intronic
1135167321 16:20150883-20150905 CAAGGGAAAGTCTCTGTAGCAGG - Intergenic
1135183030 16:20291759-20291781 CAAGTCAAAGGGTCTGGAGGTGG + Intergenic
1137339887 16:47591251-47591273 CAAGAGAAAGAGGATGGAGGTGG - Intronic
1139189014 16:64840115-64840137 AAAGAGAAGGAGGCTGAAGGTGG - Intergenic
1139716300 16:68816089-68816111 CAAGAGACAGAGGCTGCAGTAGG - Intronic
1140608183 16:76565847-76565869 CCAGAGAAACAATGTGTAGGAGG + Intronic
1142317462 16:89357091-89357113 GATGAGGATGAGTCTGTAGGAGG + Intronic
1142453060 16:90195561-90195583 CAAGAGCAAGACTCTGTCGGGGG - Intergenic
1143812367 17:9482238-9482260 CAAAAAAAAAATTCTGTAGGTGG - Intronic
1146793239 17:35764668-35764690 CAAGAGAGAAGGTCGGTAGGGGG - Exonic
1147676586 17:42210718-42210740 CAGGTGAAAGTGTCTGTAGCAGG - Intronic
1147900800 17:43782697-43782719 CAAGAGAAAGAATTTGCTGGGGG + Intronic
1148088527 17:45008913-45008935 CAAGGGACAGAGTCTGGGGGCGG + Intergenic
1148106602 17:45122034-45122056 CAAGGGAAAAAGGCTGTTGGTGG - Intronic
1150193257 17:63265996-63266018 CAAGAGAAAGAGAGGGTAAGAGG + Intronic
1150357899 17:64504157-64504179 CAAGAAAAAGAGGGGGTAGGTGG + Intronic
1150888978 17:69122713-69122735 CAAGAGAAAGAGGCAGAAAGGGG + Intronic
1151688323 17:75663004-75663026 GAAGAGAAAGAGGCTGTAACTGG + Intronic
1153101829 18:1480420-1480442 CAAGAGAGAGAGTGTGTAGGAGG + Intergenic
1153735881 18:8066752-8066774 CAGGAGACAGAGGCTGTATGAGG - Intronic
1155983340 18:32203829-32203851 CCAGAGAAAGAGTGGGGAGGGGG + Intronic
1158725609 18:59969179-59969201 CTAAAGAAGGAGTCTGTAGAAGG - Intergenic
1158883623 18:61805041-61805063 CAAGAGAAAGAGGGTGGAGAAGG - Intergenic
1160088134 18:75799251-75799273 CAATAGATAAAGTCTGTAGATGG + Intergenic
1161146787 19:2683721-2683743 CAAGAGAGAGACCCTGGAGGAGG + Intronic
1161637248 19:5396648-5396670 CAAGAGAAGGAGCCAGTATGGGG + Intergenic
1164099298 19:22040338-22040360 AAAGGGACACAGTCTGTAGGAGG - Intergenic
1164119483 19:22253060-22253082 AAAGGGACACAGTCTGTAGGAGG - Intergenic
1165533903 19:36426940-36426962 CGAGAGAGAGAGTGTGAAGGAGG - Intergenic
1165716331 19:38048125-38048147 CAAGAGAAAATCTCTGTAGGAGG - Intronic
1166421927 19:42643269-42643291 GAAGAGACAGAGTCTGAAGTGGG - Intronic
1166497382 19:43313916-43313938 CAAAAGAAAGAAACTGAAGGAGG - Intergenic
1166644892 19:44524572-44524594 AAAGAAAAAGAGTGGGTAGGGGG - Intronic
1167329000 19:48842722-48842744 CAAGAGAAAGGGACTGGAGAAGG - Intronic
1168515536 19:57007756-57007778 CAAGTGAGAGTGTCTGTCGGGGG - Intergenic
925336565 2:3102904-3102926 CAAGAGAACGGGGCTGTAGGCGG + Intergenic
926257857 2:11224768-11224790 CAAGAGAAAGAGTTCCTATGTGG + Intronic
926273459 2:11385670-11385692 TAGGAGAAAGAGCATGTAGGAGG - Intergenic
926782178 2:16483418-16483440 CAAGGGAAAAAGTGTATAGGAGG - Intergenic
927000082 2:18785865-18785887 GAAGAAAAAAAGTGTGTAGGGGG - Intergenic
927020092 2:19007601-19007623 CAAGAGACGGAGTGTGGAGGAGG + Intergenic
927178918 2:20430039-20430061 CAAGAGAAACATTATGTAGTAGG - Intergenic
927630238 2:24766866-24766888 CAAGAGAAAGAGCCCAGAGGAGG + Intronic
929412796 2:41715979-41716001 AAAGAGAAAGAGGTTATAGGAGG - Intergenic
930693024 2:54383895-54383917 CAACAGAGAGAGTGTGAAGGGGG - Intergenic
931913322 2:66925956-66925978 CAAGGGAAGGAGTCTATAGAAGG - Intergenic
933039742 2:77448667-77448689 CATGAGAGAGAGTCTCTTGGAGG + Intronic
933312815 2:80681992-80682014 CAAGAGAAACAGTCTGGAAATGG - Intergenic
935129444 2:100250450-100250472 AGAGAGAAAGAGGCTGAAGGAGG - Intergenic
936647043 2:114384141-114384163 AGAAAGAAAGAATCTGTAGGTGG + Intergenic
938231877 2:129668691-129668713 CAAGAGCAGGATTCTGCAGGGGG + Intergenic
938746485 2:134283267-134283289 CATGAGAAAGTGTCTGTGGAGGG + Intronic
939495501 2:142923090-142923112 TAAGAGGTAGAGTCTTTAGGAGG - Intronic
940354485 2:152723811-152723833 CAAGAGAAAGGATGTGTGGGAGG + Intronic
941180480 2:162253664-162253686 CCAGAGGATGAGTCTGGAGGAGG - Intergenic
941208662 2:162608233-162608255 CCAGAGAGAGACTCTGTGGGAGG + Intronic
942776991 2:179593888-179593910 CAGGAGAAAGATTATGAAGGGGG - Intronic
942927536 2:181451687-181451709 CAAAAGAAAGAGTACGTAGAAGG - Intergenic
943452610 2:188064008-188064030 AAAGAGTTAGAGTCTCTAGGTGG + Intergenic
945283530 2:208060054-208060076 CAAGAGAGAGAGAGTGAAGGTGG + Intergenic
945755978 2:213847456-213847478 CAAGAGAGAAAGACTGAAGGAGG + Intronic
945916368 2:215708615-215708637 AAAGAGATGGAGTCTTTAGGAGG - Intergenic
946440786 2:219693426-219693448 CAAGAGAGAGAGTCTGTGCAGGG + Intergenic
947165634 2:227258684-227258706 TAAGAGGTAGGGTCTGTAGGAGG - Intronic
948778735 2:240304098-240304120 CAAGTGGCAGAGTCTGTAGTGGG - Intergenic
1169223216 20:3839189-3839211 CAAAAGAAAGACTATGTAGCGGG - Intergenic
1170192664 20:13659455-13659477 AAAGAAAAAGAGGATGTAGGAGG + Intergenic
1170439059 20:16359339-16359361 CAAGAGAAAGAGTGTGAGGGAGG - Intronic
1170997456 20:21376906-21376928 CAAGAGAGAGAGGATGTAGTTGG + Intronic
1171538407 20:25920544-25920566 TAAGAGAAAAAGTCTTTAGATGG - Intergenic
1171802731 20:29640905-29640927 TAAGAGAAAAAGTCTTTAGATGG + Intergenic
1171841354 20:30215827-30215849 TAAGAGAAAAAGTCTTTAGATGG - Intergenic
1172372727 20:34407563-34407585 CAAGATAAAGAATCTGCAGCTGG - Intronic
1173199213 20:40942200-40942222 CAAGAGAAAGAGAGTGAAAGGGG + Intergenic
1173313369 20:41920711-41920733 CAAGAGACAAAGTATATAGGTGG + Intergenic
1173823624 20:46033662-46033684 GAAGAGAAGGAGTTTGGAGGTGG - Intronic
1174664984 20:52249543-52249565 CAGGAGAGAGAGACTGAAGGGGG - Intergenic
1175058831 20:56222756-56222778 CTAGAGATAGAGTCTTTAGGAGG - Intergenic
1175312457 20:58021127-58021149 CCAGAGAAAGAGTCAGTAGGAGG + Intergenic
1177402625 21:20624996-20625018 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1177609302 21:23424345-23424367 ACAGAGCAAGAGTCTGTCGGGGG + Intergenic
1177908419 21:26999794-26999816 AAAGAGAAAGAGAATGAAGGGGG + Intergenic
1178324860 21:31636706-31636728 CAACATAAAGCGTGTGTAGGGGG - Intergenic
1178714000 21:34946895-34946917 CAAGTGCATGAGTCTGAAGGTGG - Intronic
1179043274 21:37823591-37823613 AAAGAGTGAGAGTGTGTAGGAGG - Intronic
1180211174 21:46296169-46296191 CAAGTGACAGAGTCCGTGGGTGG - Exonic
1181137370 22:20777986-20778008 CAAGAGATAAAGTCTGTGTGAGG - Intronic
1182948459 22:34348099-34348121 CAAAAGAGAGAGTCTGGAAGTGG - Intergenic
1185186402 22:49403281-49403303 CCAGAGAGAGAGTCTGAAGGGGG - Intergenic
949404669 3:3701634-3701656 AAAGAGAGAGAGTCTGAAAGGGG + Intronic
949803478 3:7928933-7928955 CCAGAGAAAAAGTATGAAGGGGG - Intergenic
950095634 3:10328646-10328668 CCAGAGAAAGGGTCTGTGGGTGG + Exonic
950650456 3:14403705-14403727 GAAGAGAAATAGTCTGGAGGGGG - Intronic
950870590 3:16225134-16225156 CAAGAGAAAGAGAGTGGGGGAGG + Intronic
950904048 3:16521544-16521566 GAACAGAATGAGTCTGGAGGAGG - Intergenic
953180056 3:40586394-40586416 CAAGTCAAAGAGTTTGTAGTAGG + Intergenic
953498432 3:43408956-43408978 CAGGAGAAAGAGGCTGCAGTGGG + Intronic
954709173 3:52496470-52496492 CAAGAGAAAGCGCCTGATGGTGG - Intronic
954942991 3:54392257-54392279 AAAAAGAAAGAGTATGTAAGAGG - Intronic
955638705 3:61058582-61058604 CAGGAGAAAGAGACTAAAGGGGG - Intronic
955733632 3:62014017-62014039 CAAGAGAAAAAGGCAGTTGGTGG - Intronic
956919170 3:73908145-73908167 AAAGAGGAAGGGTCTTTAGGAGG + Intergenic
957974543 3:87426528-87426550 GAAGAGAGAGTGTGTGTAGGGGG + Intergenic
958536264 3:95408305-95408327 CAAGAGGAAGAGACTTAAGGTGG - Intergenic
961378295 3:126481501-126481523 AATGAGAAAGAGTCTGTGGGTGG - Intronic
963508477 3:146217803-146217825 CATGAGAAGCAGTCTATAGGTGG + Intronic
963681583 3:148384655-148384677 TAAGAGGTAGAGTCTGTAAGAGG + Intergenic
963785626 3:149531642-149531664 GAAGAGATGGCGTCTGTAGGAGG - Intronic
965740812 3:171872697-171872719 CAAGAGACAGAGAGTCTAGGAGG - Intronic
966929531 3:184666868-184666890 CCAGAGAAGGAGGCTGGAGGAGG + Intronic
967037455 3:185658418-185658440 TGAGAGAAAGAGTCAGTGGGCGG + Intronic
968146076 3:196299988-196300010 CAAAAGAAAGAGGGAGTAGGTGG + Intronic
968407598 4:354273-354295 CATGAGAGAGGGTCTGTGGGGGG - Intronic
970738904 4:19209581-19209603 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
971525022 4:27605821-27605843 CAAGAGGAAGAGGATGAAGGGGG - Intergenic
972031528 4:34465312-34465334 AAAGAGAATGAGTCTATAGGAGG - Intergenic
972371549 4:38428774-38428796 CAAGAGAAAGAGGATGAAGAAGG + Intergenic
972682522 4:41320173-41320195 CAAGAGAAATATTCTGAAGTTGG - Intergenic
973615678 4:52675650-52675672 TGAGTGAAAGAGTCTGTAGCTGG - Intergenic
973615880 4:52677389-52677411 TGAGTGAAAGAGTCTGTAGCTGG - Intergenic
973695556 4:53487041-53487063 GAAGAGAAAGAGTCAGTTGCAGG - Intronic
977438254 4:97028856-97028878 CAAGAGAAATATTCTGTCTGAGG - Intergenic
978219776 4:106256354-106256376 CAAGGGAGGGAGTCTGAAGGGGG - Intronic
978987833 4:115037303-115037325 GAAGAGAAAGAGACTGTAGATGG + Intronic
979378614 4:119980542-119980564 CAATTGGAAGAGTCTGTAGTTGG + Intergenic
979754552 4:124324843-124324865 GCAGAGAAAGAGTCTGCAGAGGG + Intergenic
982849805 4:160298107-160298129 AAAGAGAAAGAGACTATAGATGG - Intergenic
983475348 4:168205926-168205948 CATGAGAAACAGACTGGAGGAGG - Intergenic
983481082 4:168274760-168274782 CATAAGAAAGATTCTGAAGGGGG + Intronic
984909921 4:184664862-184664884 AGAGAAAAAGAGTATGTAGGGGG + Intronic
985706190 5:1402797-1402819 CAAGAGGAGGAGACTGGAGGTGG - Intronic
986115441 5:4769161-4769183 GAAAAGAAAGAGTGTGCAGGAGG - Intergenic
986119548 5:4819534-4819556 CAAGAAAAAGGGTCAGGAGGTGG + Intergenic
986624835 5:9714086-9714108 CATGAGGAAGATACTGTAGGAGG - Intergenic
986804168 5:11292580-11292602 CAAGAGAGAGTGTGTGAAGGAGG - Intronic
987476953 5:18402169-18402191 CAAGAGAGAGAGTGAGCAGGAGG - Intergenic
987650269 5:20732356-20732378 GGAGAGAAAGAGTATGAAGGGGG + Intergenic
988745285 5:34129112-34129134 GGAGAGAAAGAGTGTGAAGGGGG - Intergenic
989172082 5:38481896-38481918 CAAGAAAATGACCCTGTAGGAGG - Exonic
989576023 5:42989437-42989459 TAAAAGAAAGACTGTGTAGGAGG - Intergenic
991637795 5:68723600-68723622 GAAGAGAAAGAGTGGGTGGGAGG + Intergenic
992750326 5:79855330-79855352 AAGGAGAAAGAGAATGTAGGTGG + Intergenic
993437415 5:87915086-87915108 CAAGAGAAAGAGAGAGAAGGAGG + Intergenic
994783855 5:104129780-104129802 CAAGAGATGGGGCCTGTAGGCGG + Intergenic
995213448 5:109567777-109567799 CAAGTGAGAGAGGCTCTAGGAGG + Intergenic
997494276 5:134308360-134308382 AAAAAGAAAGAGTATGAAGGTGG - Exonic
1001464755 5:171953628-171953650 CAAGAGTAAGAATCAGTAAGAGG + Intronic
1001511273 5:172324284-172324306 CAAGAGAGAGAGTGGGTGGGAGG - Intergenic
1002714077 5:181214722-181214744 CTAGAGAAATAGTTTGAAGGAGG - Intergenic
1003727447 6:8781191-8781213 CCAGAGGATGAGTATGTAGGAGG + Intergenic
1004043504 6:12005963-12005985 CTGGAGATAGAGTCTTTAGGAGG + Intergenic
1004066090 6:12245812-12245834 GAAGGGAAAGAGGCTGTGGGTGG + Intergenic
1004706160 6:18125631-18125653 TAAGAGAAAAAGACTGAAGGTGG - Intergenic
1004804184 6:19184094-19184116 CAAGAGAGAGAGTAGGTGGGGGG - Intergenic
1004873876 6:19935776-19935798 AAGGAGAAAGAGTGTGGAGGTGG - Intergenic
1005175226 6:23036993-23037015 CCAGAAAAAGAGTGTGCAGGAGG + Intergenic
1005543408 6:26836860-26836882 GGAGAGAAAGAGTGTGAAGGGGG - Intergenic
1007906175 6:45463276-45463298 CAAGAGGAAAAGTCTGTACAAGG + Intronic
1009014233 6:57879029-57879051 GGAGAGAAAGAGTGTGAAGGGGG - Intergenic
1009546941 6:65032505-65032527 CAAGAGAAAGAGACAGTGGTAGG - Intronic
1010655930 6:78510962-78510984 CAAGAGAATGAGTCCCGAGGTGG + Intergenic
1011434388 6:87321852-87321874 AAAGAGAGAGAGTGTGAAGGGGG + Intronic
1011799929 6:91000814-91000836 CAAGAGAGAGAGCCAGGAGGAGG - Intergenic
1012201424 6:96411136-96411158 CAAGAGCAAGAGAGTGTTGGGGG + Intergenic
1012306922 6:97669897-97669919 CAAGATAAAAAGTCTGTTGTTGG - Intergenic
1012351049 6:98250957-98250979 GAAGAGAAAGAAACTGTAGCAGG + Intergenic
1012511715 6:100010134-100010156 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1013067553 6:106698492-106698514 CAAGAGATGGAGATTGTAGGGGG - Intergenic
1013352622 6:109319189-109319211 CAAGATAAATAGTAGGTAGGTGG - Intergenic
1013628835 6:111965062-111965084 AAAGAGAGAGAGTCAGGAGGCGG + Intergenic
1013855989 6:114572584-114572606 CAGGAGAAAGAGAGTGAAGGAGG - Intergenic
1013941843 6:115673371-115673393 AAAGATAAAGAGGCTGTAAGTGG + Intergenic
1014445630 6:121524099-121524121 CAAGAGAAAGCGCCTCTTGGGGG + Intergenic
1015386715 6:132633049-132633071 CAAGGGAAAGAATGGGTAGGAGG + Intergenic
1016139305 6:140587937-140587959 CAGGAAAAAGAGTGTGAAGGAGG + Intergenic
1016890039 6:148996554-148996576 CAAGAGAAAGAGTCTGTAGGAGG - Intronic
1018808804 6:167282354-167282376 CAAGAGAAAGTGTGCATAGGGGG + Intronic
1019574869 7:1732575-1732597 CCAGAAAAATAGTCTGCAGGTGG + Intronic
1020308799 7:6854504-6854526 CAAGAGAAACAGGCTGGTGGAGG - Intergenic
1020841997 7:13229535-13229557 CAAGTGAAAGATTCTGTAGAGGG - Intergenic
1021055380 7:16041087-16041109 CAGGAGAAAGAGGGTGAAGGGGG - Intergenic
1022172072 7:27840433-27840455 CAAGAGAGAGCTTTTGTAGGAGG - Intronic
1023832561 7:44048371-44048393 CAAGAGAAAGATTTGGGAGGTGG - Intronic
1023907962 7:44535576-44535598 AAAGAGAAAGAGAGGGTAGGAGG + Intronic
1026241317 7:68577898-68577920 TAAGAGAAGGGGTCTTTAGGAGG + Intergenic
1027558304 7:79694104-79694126 CGAGAGAGATAGTCTGAAGGAGG - Intergenic
1027600758 7:80237757-80237779 CAGGAGAAAGAGCATGAAGGGGG + Intergenic
1027677639 7:81179876-81179898 CAAGAGAAAGAGAGAGTAGGAGG - Intronic
1028850826 7:95535380-95535402 CAAGTGAAAGGGGCTTTAGGAGG + Intronic
1029480938 7:100812624-100812646 CAAGAGGAAAAGGCTGGAGGAGG + Intronic
1029696882 7:102219391-102219413 CCTGAGAAAGATTCTGTAGGGGG - Intronic
1032061293 7:128727490-128727512 GAAGAGACAGAGTCTGCAAGAGG + Intronic
1034099656 7:148439823-148439845 GAAGAGAAAGAATATGTAGGAGG - Intergenic
1034876012 7:154725461-154725483 CAAGAGAAAGAGAGTGAAGGGGG + Intronic
1036730117 8:11255548-11255570 CAAACGAAAAACTCTGTAGGTGG + Intergenic
1038067593 8:23979310-23979332 CAAGAGAGAGAGGCTCCAGGTGG + Intergenic
1038531492 8:28321465-28321487 CCATAGAAAGAGTGTGGAGGGGG - Intronic
1038722858 8:30053359-30053381 GAAAAGAAAGAGTCTGTATCTGG - Intergenic
1040626155 8:49151801-49151823 CAAGAGCAGGAGGCTGGAGGAGG + Intergenic
1040677420 8:49766891-49766913 CAAGAGAGAGAGAATGTGGGTGG - Intergenic
1040760658 8:50838437-50838459 CAAGAGAGAGCGTATGTAGGAGG - Intergenic
1040923439 8:52650314-52650336 GAAGAGAGAGACTCTGGAGGTGG + Intronic
1041085083 8:54249478-54249500 CAAGAGCAAGGGTCAGGAGGTGG - Intergenic
1041225361 8:55692231-55692253 CAAGAGGAGATGTCTGTAGGTGG - Intergenic
1042758249 8:72242077-72242099 CAAGAGAAAAAGCCTCTAGTAGG - Intergenic
1043145532 8:76648861-76648883 CAGGAGGAAGAGTGTGCAGGGGG - Intergenic
1043663736 8:82781722-82781744 AAACAGAAAGAGTCTGTATCAGG + Intergenic
1046577611 8:116050762-116050784 GGAGAGAAAGAGTAGGTAGGAGG - Intergenic
1048383116 8:133885843-133885865 CAAGAGAGAGAGACTGGAGAAGG + Intergenic
1048396541 8:134019513-134019535 CAAGGGAAAGAGTTGGTGGGAGG + Intergenic
1048536137 8:135296723-135296745 CAAGAGATAGGATCTGTAAGAGG + Intergenic
1049402890 8:142438266-142438288 CAAGAGAGAGACTGGGTAGGGGG + Intergenic
1049498958 8:142951057-142951079 CAAAAGAAAGAGTATAAAGGCGG - Intergenic
1049915753 9:316798-316820 CAAGACAAAGAGACTGAAGCAGG - Intronic
1050225942 9:3455406-3455428 CATGAGAAAGAGTATATAGTAGG - Intronic
1051802163 9:20947545-20947567 CAAGGGAAAGATTCTGGAGATGG + Intronic
1051940527 9:22500606-22500628 CAAGAGGAAGAGAGTGAAGGGGG - Intergenic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1056819797 9:89831234-89831256 TTAGAGAAAGGGCCTGTAGGAGG + Intergenic
1057811544 9:98260929-98260951 TAAGAGGTAGAGTCTGTAGCAGG - Intergenic
1059298645 9:113295333-113295355 CAAGAAAAAAAGTCTGTATATGG - Intergenic
1059798598 9:117727195-117727217 AAAGAGAAAGACTCTGCAGGAGG - Intergenic
1186384399 X:9094319-9094341 CCATAGAAAGAGTCTGTGAGTGG - Intronic
1187204896 X:17172404-17172426 CAGGAGAAAGAGAGTGAAGGGGG - Intergenic
1189781305 X:44516882-44516904 CAACAAAAGGAGTCTGTATGGGG - Intergenic
1193041288 X:77006544-77006566 TAAGAGGAAGAGTATGTTGGAGG - Intergenic
1194160471 X:90443797-90443819 AAAGAGACAGTGTGTGTAGGAGG + Intergenic
1195608650 X:106838242-106838264 CAATAGAAAGTGTCTTGAGGGGG - Intronic
1197405785 X:126047540-126047562 AAATAGAAAAAGACTGTAGGTGG + Intergenic
1197921145 X:131595839-131595861 TAATACAAAGAGTCTGTAGGAGG + Intergenic
1200038966 X:153352190-153352212 CAAGTCAAGGAGTCTGTAGTGGG - Exonic
1200290535 X:154868305-154868327 CAAGAGAGAGTGTGTGAAGGAGG - Intronic
1200506761 Y:4020741-4020763 AAAGAGACAGTGTGTGTAGGAGG + Intergenic