ID: 1016890840

View in Genome Browser
Species Human (GRCh38)
Location 6:149005361-149005383
Sequence CAGAAGCTGGAGAAGAATTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 368}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016890831_1016890840 29 Left 1016890831 6:149005309-149005331 CCATAGAATTGGAGAGGGTTGAG 0: 1
1: 0
2: 2
3: 6
4: 127
Right 1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG 0: 1
1: 0
2: 1
3: 39
4: 368
1016890836_1016890840 2 Left 1016890836 6:149005336-149005358 CCTGGCTGTAGAGGAAAGAAGAC 0: 1
1: 0
2: 1
3: 27
4: 226
Right 1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG 0: 1
1: 0
2: 1
3: 39
4: 368
1016890835_1016890840 3 Left 1016890835 6:149005335-149005357 CCCTGGCTGTAGAGGAAAGAAGA 0: 1
1: 0
2: 3
3: 35
4: 329
Right 1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG 0: 1
1: 0
2: 1
3: 39
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016890840 Original CRISPR CAGAAGCTGGAGAAGAATTC GGG Intronic
900839128 1:5032999-5033021 CAGAAGTTGAAGATGTATTCTGG - Intergenic
901189793 1:7402735-7402757 CAGAAGCTGGTGGAGACTTGGGG + Intronic
901831031 1:11892590-11892612 CAGAAGCTGGAGATGAGCTGGGG - Intergenic
902050780 1:13562228-13562250 CAGAGGCTGAAGAAGAGTTGGGG - Intergenic
902118120 1:14138622-14138644 CAGAAGTGGGAGAAGATATCAGG + Intergenic
902155121 1:14478909-14478931 GAGAAGCAGGAAAATAATTCAGG + Intergenic
902634029 1:17723499-17723521 CAGAAGATGTGGAAGAAATCAGG - Intergenic
904130426 1:28271776-28271798 CAGAAGCTGGTAAAGTAGTCAGG - Exonic
905925574 1:41747089-41747111 CAGCAGCAGGATAGGAATTCAGG + Intronic
906039262 1:42774890-42774912 CAGAGGCTGGAGTAGATTTTTGG - Intronic
906516394 1:46441252-46441274 CAGAAGCTGGGGCAGGACTCAGG - Intergenic
907422944 1:54359358-54359380 CAGAGGCTGCAGAAGAAACCAGG + Intronic
907789161 1:57645007-57645029 GAGAAGCTGAAGGAGAATCCAGG + Intronic
907903815 1:58766093-58766115 GAAAAGCTGGAGAAGAAAACAGG - Intergenic
908842245 1:68291860-68291882 AAATAGCTGAAGAAGAATTCTGG + Intergenic
909764165 1:79334019-79334041 CTGAAGCTGGAAAACATTTCTGG - Intergenic
909775395 1:79478613-79478635 CAAAAGCTGGACAAGAGCTCAGG - Intergenic
909986973 1:82173010-82173032 CAGATACTGGACAAGAATTTGGG + Intergenic
910486671 1:87722414-87722436 AAGAAGCTAAAGGAGAATTCAGG - Intergenic
910545702 1:88414813-88414835 AAGAAGCTGCAGAAGAAGTTTGG - Intergenic
911040709 1:93588764-93588786 CAGGAGCTGAGGAAGAATTTCGG - Intronic
912469814 1:109898885-109898907 CAGAGGCTGGAGTTGAATCCAGG + Intergenic
912677131 1:111693335-111693357 CAGAAGCTGGAGAGATATTGGGG + Intronic
914828641 1:151154537-151154559 CTGAAGCTGGAGAGGAAAACAGG + Intergenic
916139635 1:161683955-161683977 CAGCAGCTGCAGGTGAATTCAGG - Intergenic
916207645 1:162331038-162331060 GAGAAGCTTGAGAACCATTCAGG + Intronic
916323864 1:163535238-163535260 CAGAAGCTGGAGAGGTAGTTGGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916636106 1:166670427-166670449 CAAAAGGAGGAGAAAAATTCAGG + Intergenic
917042325 1:170819535-170819557 CAGAGGGTGGAGAAGAATTAGGG + Intergenic
917991531 1:180385153-180385175 CATAACCTGGAGAACATTTCAGG - Intronic
918311469 1:183288441-183288463 CAGAAGCTGGCAAAGAATGTAGG - Intronic
918876426 1:190050571-190050593 TAGAAGGTGGAGGAGAATTATGG - Intergenic
919049091 1:192490599-192490621 CAGAGGTAAGAGAAGAATTCAGG - Intergenic
919279620 1:195471307-195471329 CAGAAGCTATAAAATAATTCTGG + Intergenic
920795549 1:209132988-209133010 CAGATGCTGGACGAGAACTCAGG - Intergenic
921261994 1:213392802-213392824 CAGAGCCTGGAGGAAAATTCAGG + Intergenic
922368358 1:224886771-224886793 CAGAGGCTGTGGAAGAATTGGGG - Intergenic
922987207 1:229874980-229875002 CAGGAGCTGGAGAGGAAGTGGGG + Intergenic
923730975 1:236549564-236549586 GAAAAGCTGGAAAAGAATTAAGG - Exonic
923947044 1:238899685-238899707 CAGCAGCTAGAGAAAAATTAAGG + Intergenic
924607148 1:245544591-245544613 CAGAAGCAGGGCAAGAAGTCAGG + Intronic
924772687 1:247090359-247090381 CAGAAGCTGGCCAGGAATTGGGG + Intergenic
1063506296 10:6603302-6603324 CAGAGCCTTGAGAAGAATGCAGG - Intergenic
1063584058 10:7334957-7334979 CAGAAGCTAGGGAGGAATTGAGG + Intronic
1063997989 10:11639456-11639478 CCGAAGCCGGAACAGAATTCTGG - Intergenic
1065435287 10:25699168-25699190 CAGAAGTAGGAGATGAAGTCAGG + Intergenic
1065864170 10:29899171-29899193 CAGAAGTTGGGGGAGATTTCTGG + Intergenic
1066746896 10:38610078-38610100 CAGAAGCTGGAAAACAAGTTAGG + Intergenic
1067269937 10:44782617-44782639 CAGAAGCTGGAAAGGAAAGCAGG + Intergenic
1067319262 10:45202109-45202131 CAAAAGCTTGTGAAGAGTTCTGG - Intergenic
1067894640 10:50165773-50165795 CAGAACAAGGACAAGAATTCAGG + Intergenic
1067954204 10:50774488-50774510 CAGAACCAGGACAAGAATTCAGG - Intronic
1068410629 10:56649598-56649620 CAGAAGCTGGTGAAGAAAGAGGG - Intergenic
1068486272 10:57663101-57663123 CAGAAACTAGAGGAGAATTGTGG + Intergenic
1069620014 10:69831524-69831546 CAGAAGCTTGAGAAGCTTGCAGG - Intronic
1069757466 10:70782001-70782023 CTGAAACTGGAGAAGAAGTCAGG - Exonic
1070529034 10:77320183-77320205 AAAATGGTGGAGAAGAATTCTGG + Intronic
1070539967 10:77408931-77408953 CAGAAGGTGGGGAGGAATTCAGG + Intronic
1072332976 10:94371661-94371683 CAGATGCTGGAGTAGATATCTGG - Intergenic
1072895499 10:99362906-99362928 CTGAAGGGGGAGAAGATTTCAGG - Intronic
1072982066 10:100107087-100107109 CTGAAGCTGGTGAAGAGCTCAGG - Intergenic
1073368716 10:102967432-102967454 CAGAGGCTGGAGATGAAAGCAGG - Intronic
1073525791 10:104180871-104180893 GAGAGGCAGGAGAAGAGTTCAGG - Intronic
1074181741 10:111071303-111071325 CAGAAGCAGGACCAGAACTCAGG + Intergenic
1074754447 10:116614023-116614045 CAGAAGCTGTGGAAGAAGCCTGG - Intergenic
1076362396 10:129898474-129898496 CAGAACAAGGAGAGGAATTCAGG - Intronic
1076912948 10:133401463-133401485 CAGAAGCTGCAGAACAAGTAGGG - Intronic
1077506825 11:2933447-2933469 CAGCAGCTGGAGTAGGATGCGGG + Intergenic
1078876850 11:15407887-15407909 GAGAAGCTGAAGAAGGATCCAGG - Intergenic
1080452866 11:32393150-32393172 CAGAATCTGAGGCAGAATTCTGG + Intronic
1080902924 11:36512506-36512528 CAGAAGCAGGAGTAGAACTTTGG - Intronic
1080932552 11:36827192-36827214 CAGAAGCTGGAGTAGAACAGTGG - Intergenic
1082909475 11:58354047-58354069 GAGAGGCTGTAGATGAATTCAGG + Intergenic
1083205172 11:61144452-61144474 CAGAAGCAGGAGGAGAACGCAGG + Intronic
1083717877 11:64589375-64589397 CAGGAGTTTGAGAAGAATGCAGG + Intergenic
1085901457 11:80704615-80704637 CAGAACCTGGATCAGAATGCAGG - Intergenic
1085905470 11:80755947-80755969 CAGAACCTGGAGTTGAACTCAGG - Intergenic
1087135005 11:94707692-94707714 CAGAAGGGGGAGCAGATTTCAGG - Intronic
1087922931 11:103887504-103887526 CTGAGGCTGGAAAAGCATTCTGG - Intergenic
1089409422 11:118227227-118227249 CAGCAGCTAAAGAAAAATTCTGG + Exonic
1090051489 11:123383741-123383763 TAGAAGCTAGAGAAGAATTTAGG - Intergenic
1090576675 11:128112597-128112619 CAGATGCTGGAGAAGATGTGGGG + Intergenic
1090991878 11:131825096-131825118 CAGAAGCTGGACAAGAAGCCTGG - Intronic
1092026676 12:5246567-5246589 CAGAAGCTAGAAAAGAGGTCTGG - Intergenic
1092047604 12:5443163-5443185 CAGAAGCTGGACTAGACCTCAGG - Intronic
1092416256 12:8292575-8292597 CAGAGGCTGAGGAAGAATTCAGG + Intergenic
1092495508 12:8989799-8989821 CAGAGGGTGCAGAAGAATTGAGG + Intronic
1093226588 12:16491438-16491460 CAGAAGCAGAAGCAGAATACAGG - Intronic
1094752744 12:33431358-33431380 TAGAAGCGGGAGATGAATACTGG + Intronic
1095139704 12:38646476-38646498 CAGAATGTGGACAAGAATTCAGG - Intergenic
1095916538 12:47485750-47485772 CAGAGGCTGTAGAAGAATGTGGG + Intergenic
1096072776 12:48784641-48784663 CAGAAGCAGAAGAAAAAATCTGG + Intronic
1096968108 12:55644634-55644656 AAGAAGCAGGTGAACAATTCTGG - Intergenic
1098315369 12:69186812-69186834 AAGAAGCTGGAGAAGGTTTCAGG + Intergenic
1098370312 12:69752235-69752257 CAGAAGCAGGAGGACAATTGTGG - Intronic
1098874367 12:75851560-75851582 CAGAAGCTTTAGAAGACTTGTGG - Intergenic
1099451172 12:82808680-82808702 CAGTGGCAGGAGAAGAATACTGG - Intronic
1101055239 12:100905700-100905722 CAGCAGCTGGAGGAGAAGTAAGG + Intronic
1101104544 12:101426975-101426997 CAGAAGCTTGAGAGAAAATCAGG - Intergenic
1102560952 12:113762028-113762050 CAGAGGCTGGAAAATGATTCCGG + Intergenic
1103399977 12:120637225-120637247 CAGAAACTGGAGAGGAAAGCAGG - Intergenic
1103940909 12:124500706-124500728 CCGGAGCTGGAGAGGAATGCAGG - Intronic
1104998321 12:132673038-132673060 CAGAGGCGGCAGTAGAATTCTGG - Intronic
1105991726 13:25628675-25628697 CAGAAGCTGGAGGAGAAGCCTGG - Intronic
1107806875 13:44161532-44161554 CATAATCAGGAGAAGAATGCTGG - Intergenic
1107812746 13:44215911-44215933 AAGCAGCTGGAGAAGTAATCAGG + Intergenic
1109443757 13:62406805-62406827 CAGAGGCTGGGAGAGAATTCCGG + Intergenic
1109654132 13:65367333-65367355 AAGGAGCTGGAGAAACATTCAGG - Intergenic
1109879857 13:68458206-68458228 TATTAGCTGGAGTAGAATTCAGG - Intergenic
1112761684 13:102699254-102699276 CAATAGCTGGAGGAGACTTCAGG - Intergenic
1112808586 13:103190238-103190260 TAGAAGCTGCATAAGAAGTCAGG - Intergenic
1112885635 13:104167808-104167830 CAGAAGCTGGAGGAGGATTTGGG + Intergenic
1114016362 14:18433310-18433332 CAGAAGCAGTAGCAGTATTCTGG + Intergenic
1114338777 14:21721074-21721096 CAGCAGATAGAGAAGGATTCAGG - Intergenic
1114354072 14:21888229-21888251 AAGGAGGTGGAGCAGAATTCTGG + Intergenic
1115379791 14:32722824-32722846 TGGATGCTGGACAAGAATTCAGG + Intronic
1115464169 14:33696303-33696325 CAGAACCAGGAGTAGAATACGGG - Intronic
1115618480 14:35119007-35119029 CAGAAGCTGGAGAGGGATGTGGG + Intronic
1115731090 14:36270790-36270812 CAGAAGCTAGAGAAGAGTTTGGG + Intergenic
1115757065 14:36539395-36539417 GAGAAGCTGAAGGAGAATTCAGG + Intergenic
1116692673 14:48130387-48130409 CAGTAGCTATAGAAAAATTCAGG - Intergenic
1116952836 14:50894874-50894896 CAGAGGCTGAGGAAGAATTGAGG - Intronic
1117120746 14:52565851-52565873 CAGAATTTGGACTAGAATTCTGG - Intronic
1118350396 14:64969636-64969658 CAGAAGCGGAGGAAGAAATCTGG + Intronic
1118786741 14:69052247-69052269 CAGAAGATGTGGATGAATTCAGG - Exonic
1119154083 14:72392512-72392534 CAGAAGCTGAAGGAAAATTCAGG + Intronic
1119269213 14:73287235-73287257 CAGAAGCGGGAGAAGGAATGTGG - Exonic
1119747223 14:77052948-77052970 CAGGAACTGGAGAAGAACCCGGG + Intergenic
1120647437 14:87090426-87090448 CAGAAGCATGGGAAGAACTCAGG - Intergenic
1122711629 14:103662851-103662873 GAGGACCTGGAGAAGACTTCAGG + Exonic
1202894209 14_KI270722v1_random:188690-188712 AAGAAGAAGTAGAAGAATTCAGG - Intergenic
1124041949 15:26113563-26113585 CAGAGGCTGGAAAAGAAAACAGG - Intergenic
1125160466 15:36637597-36637619 TAAATGCAGGAGAAGAATTCTGG - Intronic
1125454694 15:39845087-39845109 CAGAGGAGGAAGAAGAATTCTGG + Intronic
1125639542 15:41218520-41218542 CAAACCCTGGAGAAGAATTTAGG + Intronic
1128234227 15:66056592-66056614 CAAAAGCCAGAGAAGAATGCAGG + Intronic
1128734352 15:70044363-70044385 CAGAAGCTGGGCTAGGATTCTGG - Intergenic
1128749809 15:70140794-70140816 CTGCAGCTGGAGAAGAAGGCAGG + Intergenic
1129677675 15:77641242-77641264 CATCAGCTGGAGAAGAAGGCAGG - Intronic
1129705439 15:77791562-77791584 TACAAGCAGGAGAAGGATTCTGG + Intronic
1130608670 15:85340447-85340469 CAGAAACAGGAGAAGAAAACAGG + Intergenic
1131863005 15:96674722-96674744 CAGAAGCGGGGGAGGAATTTGGG + Intergenic
1133642532 16:7731474-7731496 CATATGCTGAAGAAGGATTCTGG + Intergenic
1136736166 16:32469564-32469586 CAGAAGCTGGAAAACAAGTGGGG - Intergenic
1138722947 16:59103068-59103090 CAGCAGCTGGTGAAAAATTTTGG - Intergenic
1139389908 16:66600898-66600920 AAGAAGGTGGAGAAGCATTCTGG + Intergenic
1139801214 16:69524500-69524522 GAGAACCTGGAACAGAATTCTGG + Intergenic
1139910100 16:70392409-70392431 CAGCAGCTAAAGAAGTATTCAGG + Intronic
1139974687 16:70800383-70800405 CAGAAGCTGGGTAAGAAACCAGG + Intronic
1141231778 16:82174223-82174245 CAGAAACTGGAGGAGAATCTGGG + Intergenic
1141539496 16:84708597-84708619 AAGAAGATGGAGAAAAATTCAGG - Intronic
1203016906 16_KI270728v1_random:360010-360032 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1203035241 16_KI270728v1_random:633168-633190 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1143126243 17:4642484-4642506 AAGAAACTGGAGACGAATTAGGG - Intergenic
1144877714 17:18411095-18411117 CAGAAGGTGGGGAAGAAGACTGG - Intergenic
1145154515 17:20533308-20533330 CAGAAGGTGGGGAAGAAGACTGG + Intergenic
1145751796 17:27360628-27360650 CAGAAGCTGGAGGAGGACTGTGG + Intergenic
1145909501 17:28534391-28534413 GAGAAGGTGGAGAACAAATCAGG + Exonic
1147357076 17:39906504-39906526 CAGGAAGTGGAGAAGAATTTGGG - Intronic
1148546559 17:48523725-48523747 TAGAAGATGGATAAGAAGTCTGG - Intergenic
1149098871 17:52879359-52879381 GGGAAGCTGGTGAAAAATTCTGG + Intronic
1149375926 17:56043940-56043962 CAGAAGCTGGAGGTGAATATAGG + Intergenic
1149886531 17:60345623-60345645 CAGAAGATGGGTAAGAAATCAGG + Intronic
1151869477 17:76826763-76826785 TGGAAGCTGGTGAATAATTCAGG - Intergenic
1152132357 17:78485000-78485022 AAGCCGCTGGAGAAGAAATCGGG - Exonic
1153519184 18:5936003-5936025 TAAAAGGTGGAGAAGAGTTCTGG + Intergenic
1153784875 18:8525849-8525871 CTGAGGCTGGAGAAGAAAGCAGG + Intergenic
1154376164 18:13811778-13811800 CAGATGTTGGAGCAGATTTCTGG + Intergenic
1155545164 18:26907184-26907206 GAGAAGCTTGAGAAAAAGTCAGG + Exonic
1155683722 18:28521019-28521041 TAGACGCTGGACAAGAATTCGGG + Intergenic
1156680147 18:39578501-39578523 GAGAAGCTAGAGAAAAGTTCTGG + Intergenic
1156684372 18:39627122-39627144 CGGACACTGGACAAGAATTCAGG - Intergenic
1157392438 18:47314018-47314040 CAGAGGCTGGAGAAGAGGCCAGG - Intergenic
1157722973 18:49939608-49939630 CAGAGGTTGGAGCAGGATTCCGG - Intronic
1158303527 18:56079441-56079463 CAGAAGCTGTAGGAATATTCAGG + Intergenic
1158634086 18:59140638-59140660 CAGAAGTTAGAGAAGGCTTCTGG - Intronic
1159238386 18:65707363-65707385 CAAAATCTGGAAAACAATTCAGG + Intergenic
1160141299 18:76325553-76325575 CAGAAGGTGGAGAAGGCTTGTGG + Intergenic
1162504868 19:11077510-11077532 TAGAACCTGGAGTAGAATTCTGG - Intergenic
1162552895 19:11367703-11367725 CAGAAGGTGGAGAAGCTCTCTGG + Intergenic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165389464 19:35529965-35529987 CAGGAGCTGGAGAGGAACCCCGG - Intergenic
1165803722 19:38567862-38567884 AGGAAGCTGGAGGCGAATTCTGG + Exonic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1166640539 19:44491390-44491412 TAGAACCTGGGGAAAAATTCAGG - Intronic
1167769717 19:51507539-51507561 CAGATGCTGGAGAGATATTCAGG - Intergenic
1167780252 19:51594348-51594370 CAGCAGCTGGCAGAGAATTCTGG + Intergenic
1168473914 19:56662603-56662625 CAGAGTCTGAAGAAGAAATCTGG - Exonic
924963942 2:58408-58430 TGGATGCTGGACAAGAATTCAGG + Intergenic
925649191 2:6071097-6071119 ATGAAGCTGGAAAAGAATTTTGG + Intergenic
926513649 2:13813443-13813465 AATAAGCTGGAGAAGAATGTGGG - Intergenic
927122090 2:19975029-19975051 CATAATCTGGAGAAAAATTCTGG - Intronic
927979814 2:27367960-27367982 CAGAAGCTGGGGTAGTATTGGGG + Intronic
929537157 2:42790966-42790988 GAGAAGCTGCTGAAGAGTTCTGG - Intronic
929625934 2:43406806-43406828 CAACAGCTGGAAAAGCATTCCGG + Intronic
930395121 2:50812979-50813001 CAGAAGCTGGAGATCAGTTTGGG + Intronic
930682079 2:54267344-54267366 CAACAGCTAGAGGAGAATTCAGG + Intronic
930769395 2:55116696-55116718 CAGAGGCAGGACCAGAATTCAGG + Intergenic
931465366 2:62482022-62482044 GAGAAGCTGAAGAAGGATCCAGG + Intergenic
931636098 2:64341816-64341838 GAGAAGCAGGAGAAGTACTCTGG - Intergenic
932167941 2:69525363-69525385 CAGAAGGTAGAGAATAATCCGGG - Intronic
934164529 2:89282215-89282237 AAGAAGGTGGTGAAGAATTTTGG - Intergenic
934187332 2:89758678-89758700 CAGAAGCTGGAAAACAAGTGGGG - Intergenic
934202745 2:89900309-89900331 AAGAAGGTGGTGAAGAATTTTGG + Intergenic
934309302 2:91849260-91849282 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
935108874 2:100073386-100073408 CAGAAGCTGGAGAGGCATGAAGG + Intronic
935566843 2:104618336-104618358 CAGAAACTGAAGAGGAATTCAGG + Intergenic
935668636 2:105536288-105536310 CAGAAGCTGGGGGAGAGGTCTGG + Intergenic
936390013 2:112063442-112063464 TTGAAGCTGGAGAAGAGTGCTGG - Intronic
936732509 2:115401141-115401163 CAGAAGCTGAGGAAGACTTGAGG + Intronic
937735116 2:125278675-125278697 CAGAAGCTGGGGAATAACACAGG + Intergenic
938141489 2:128798319-128798341 CAGAAGCTGGAAAAGAACCCAGG - Intergenic
938326970 2:130414110-130414132 CAGACACTAGAGAAGAATTTGGG - Intergenic
938362973 2:130707366-130707388 CAGACACTAGAGAAGAATTTGGG + Intergenic
941149944 2:161902056-161902078 CAGAATCTGTGGAAGAACTCTGG - Intronic
941496247 2:166207926-166207948 AAGAAGCTGGAGAAAAACTGAGG + Intronic
943164583 2:184304324-184304346 CAGAATGTGGGGAACAATTCAGG - Intergenic
943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG + Intergenic
943678519 2:190742557-190742579 CAGAAGCTGAAGGAAAATCCAGG + Intergenic
943824121 2:192366766-192366788 CAGAAGTGGGAATAGAATTCAGG + Intergenic
944054504 2:195509495-195509517 AAGTAGCTGGAGAAGAATTTGGG - Intergenic
944071166 2:195671056-195671078 CAGAATCATGAGAGGAATTCTGG - Intronic
944355642 2:198784462-198784484 CAGATGCTGGAGAAGATGTGGGG - Intergenic
944565597 2:200987307-200987329 CAGTTGCTGGAGAAGGATCCTGG - Intronic
945853307 2:215035803-215035825 CAAAAGCTGGAGAAGTAAGCAGG - Intronic
946471424 2:219964516-219964538 TGGATGCTGGATAAGAATTCGGG + Intergenic
947674566 2:231966151-231966173 AAGAAGAAGAAGAAGAATTCTGG - Intronic
947990506 2:234484037-234484059 CAGAAGCTGGGGGAGAAGCCTGG + Intergenic
948682643 2:239646388-239646410 CGGGAGCTGGAGATGGATTCTGG - Intergenic
1168981577 20:2008494-2008516 AAGAAGCTAGAGAAGAAATCGGG - Intergenic
1170286334 20:14713945-14713967 CAGAGGTGGGAGATGAATTCAGG + Intronic
1170290083 20:14759754-14759776 TAGATGCTGGAGAGAAATTCTGG + Intronic
1173029139 20:39338544-39338566 CAGAGGCTGGAGAAGCAGGCAGG + Intergenic
1175189476 20:57201549-57201571 CAGCAGCTGGAGAAGAAAGTGGG + Intronic
1175483914 20:59331166-59331188 CACAAGGTGGACAGGAATTCCGG - Intergenic
1176208048 20:63901500-63901522 AAGAAGCAGGAGCTGAATTCAGG + Intronic
1180440869 22:15364183-15364205 CAGAAGCAGTAGCAGTATTCTGG + Intergenic
1180536385 22:16396370-16396392 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1181286656 22:21757264-21757286 TAGAAGTTGGAGAGGAATCCTGG - Exonic
1181747653 22:24967005-24967027 CAGAAGCTGGACTAAAACTCAGG - Intronic
1182118623 22:27772963-27772985 GAGAATCAGGAGAAGAATTTGGG + Intronic
1182148058 22:28009547-28009569 CAGAAGCAGGAGAATGATCCAGG + Intronic
1182600519 22:31459831-31459853 CAGAGCCTGGAGTAGAATCCAGG - Intronic
1182670755 22:31993824-31993846 CAGAAGCTGGAGGAGAGGCCAGG - Intergenic
1183285963 22:36964225-36964247 CAGAAGGTGGAGGAGCATGCAGG - Intergenic
1184805542 22:46792904-46792926 CAGCAGCTGGTGGAGAATGCGGG - Intronic
949407741 3:3732470-3732492 CAGAAGCTGGGAGAGAGTTCTGG - Intronic
949565905 3:5244628-5244650 CAGATGCTGGAGAAGATGTGGGG + Intergenic
949707954 3:6840515-6840537 CAGAAGCTGCAGCTGAAATCTGG - Intronic
949724293 3:7025531-7025553 GAGATGATTGAGAAGAATTCTGG - Intronic
951027618 3:17846315-17846337 CAGCAGCTGGAGAGGAAGTCAGG - Intronic
951431892 3:22617645-22617667 TAGAAGCAGGAGAAAAATTCGGG - Intergenic
952396133 3:32922301-32922323 CAAAGGCTGGAGAAGCCTTCCGG + Intergenic
953929400 3:46998504-46998526 CAGAAGCTGCGGAAGAAGTACGG + Exonic
954272111 3:49518069-49518091 AAGAAGCTGGTGAAGAACTGAGG + Intronic
955342781 3:58138265-58138287 CAGGACCTGGAGAAGAGTTCAGG - Exonic
956807512 3:72830820-72830842 CAGAAGATGGAGAAAAATAAGGG + Intronic
957059978 3:75474064-75474086 CAGAGGCTGAGGAAGAATTGGGG + Intergenic
957824474 3:85422968-85422990 TGGACGCAGGAGAAGAATTCAGG - Intronic
957944361 3:87043704-87043726 CAGAATGTAAAGAAGAATTCAGG - Intergenic
959688977 3:109178138-109178160 GAGAACCTGGAGCAGAGTTCCGG + Intergenic
962583341 3:136818238-136818260 CAGAACCTGGAGAAAACTGCAGG + Intergenic
964079322 3:152732870-152732892 AATACGCTGGAGAACAATTCAGG + Intergenic
964669489 3:159209462-159209484 GAGAAGCTGGAGGAGAAGCCAGG + Intronic
965044423 3:163557389-163557411 CAGAGGCTGGGGCAGAGTTCTGG - Intergenic
965361974 3:167752596-167752618 CAGAAGCTGAAGAAGAAATTGGG - Intronic
965442119 3:168727566-168727588 CAAATCCTGGAGAATAATTCAGG + Intergenic
967194703 3:187016366-187016388 CAGCACCTGGAGAAGAGTGCGGG + Intronic
968167064 3:196475249-196475271 CTGAAGCTGTACAAGAAGTCAGG - Exonic
968332318 3:197881560-197881582 CAGTAGCAGGAGAAGTATTAGGG + Intronic
968451003 4:675987-676009 CAGAAGCTGGAGAAAAGATCAGG - Intronic
968751306 4:2390527-2390549 CAGAAGCTGGAGAAGCCATCTGG + Intronic
968844232 4:3031061-3031083 CAGGTGGTGGAGAAGACTTCAGG + Intronic
970748959 4:19334538-19334560 CAGAAGCTAGGGAAGGATCCTGG + Intergenic
971197194 4:24480833-24480855 CAGAAGATCAAGAAGAAGTCTGG + Intergenic
971459772 4:26882583-26882605 TAGTAGCTGGAGGTGAATTCAGG + Intronic
972205313 4:36764903-36764925 CAGCAGCTGGAGAAGCACTGTGG + Intergenic
972385579 4:38562519-38562541 CAGCAGCTGGAAAAGACATCTGG - Intergenic
973222561 4:47745596-47745618 CAGAAGCAGGAATAGAATCCTGG + Intronic
974306625 4:60151058-60151080 CAGATGCTGGAGAAGATGTGAGG - Intergenic
976771923 4:88662427-88662449 CAACAGCAGGAGAATAATTCTGG - Exonic
978136192 4:105263633-105263655 GAGAATCAGGAGAAAAATTCAGG + Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
980238953 4:130147826-130147848 AAAAAGCTGGTTAAGAATTCAGG - Intergenic
980615112 4:135210037-135210059 AAGAAGCTGAAGAATATTTCTGG - Intergenic
981155178 4:141426756-141426778 GAGAAGCTGGAGTACAATTCAGG + Intergenic
981714138 4:147736233-147736255 CAGAGCCTGGACAAGAATTTAGG + Intronic
981848331 4:149196259-149196281 CAGATGCTGCAGAAATATTCTGG + Intergenic
982034658 4:151333884-151333906 CAGAAGCTGGAAGAGAAGCCTGG - Intergenic
983275584 4:165613457-165613479 CAGAAGCTGGGGGAGAAACCTGG - Intergenic
983651721 4:170042626-170042648 CAGAAGCTGGGAGAGAATCCTGG - Intergenic
983826912 4:172273905-172273927 CAGAAGCAAGAGAAGCAGTCAGG + Intronic
985352128 4:189075623-189075645 CAGATGCTGGAGAAGATGTAGGG + Intergenic
986486635 5:8244628-8244650 CAGCAGCGGGAGAAGTATGCAGG + Intergenic
986875703 5:12106032-12106054 CAGAGGCTAGAGAAGAAATAAGG - Intergenic
987593947 5:19970988-19971010 CAGCAGCTAGAGAAGAAATATGG - Intronic
988373226 5:30400042-30400064 TAGGAACTGGAGGAGAATTCTGG - Intergenic
988670809 5:33379204-33379226 AAGAAGCTGGAGTAGAAATCAGG + Intergenic
989011934 5:36881748-36881770 AAGAAGCTGAAATAGAATTCAGG + Intronic
989089500 5:37715314-37715336 GAGAAGATTGAGAAGATTTCTGG + Intronic
989732536 5:44665088-44665110 CAGAAGCGGGACAAGAACTCAGG + Intergenic
990499006 5:56376455-56376477 TGGATGCTGGACAAGAATTCAGG - Intergenic
990980974 5:61602295-61602317 GAGAAGCTGGAACATAATTCTGG - Intergenic
991372666 5:65935932-65935954 CAGGAGCTGGAGACCAATCCTGG - Intronic
991455061 5:66794264-66794286 CAGAAGCTGGAGTTGAGCTCAGG - Intronic
993652917 5:90543563-90543585 GAGAAGCTGGAAAACACTTCTGG - Intronic
994433208 5:99695261-99695283 CAGTTGCTGGACAAGAATTCGGG - Intergenic
995255868 5:110045717-110045739 CAGATACTGGAAAGGAATTCAGG - Intergenic
995989608 5:118221438-118221460 CAGAAGCTGCAGAAGAAAAATGG - Intergenic
997770759 5:136550707-136550729 CAGAGGCTGAGGAAGAATTGGGG + Intergenic
997856519 5:137377718-137377740 CATCAGCTGTAGAAGGATTCCGG + Intronic
997870797 5:137503688-137503710 CAGAACCATGAGAAGAAATCTGG - Intronic
998400887 5:141848631-141848653 GAGAAGTTGGAGAAGAAGGCAGG - Intergenic
999122109 5:149217609-149217631 CAGAATCTGGAGACTAATTAGGG - Intronic
999827215 5:155285236-155285258 AATAAGCTGGTGAAGAAATCAGG - Intergenic
1000209773 5:159098370-159098392 CAGGGGCTGGAGAAGACTTTTGG + Intronic
1000228274 5:159290874-159290896 CAGGAGCTGGAGGAAACTTCTGG - Intergenic
1001797552 5:174514733-174514755 CAGCAGCTGGCGACGAATGCCGG - Intergenic
1002681365 5:180967862-180967884 CAGATGCTTGAGAAAACTTCAGG - Intergenic
1003129383 6:3382224-3382246 CAGATGCTGGAGATGAATCAGGG + Intronic
1004721105 6:18267980-18268002 CAGAAGCTGAAACAGAATTTGGG + Intergenic
1005825589 6:29629919-29629941 CAGAAGATGAAGAACAACTCAGG - Intronic
1006450526 6:34103370-34103392 CAGAAGCTGGAGAAGAATAGTGG + Intronic
1007895971 6:45358771-45358793 CAGAGTCTAGAGAAGCATTCAGG + Intronic
1007898563 6:45387985-45388007 GAGTAGCTGGAGAAATATTCAGG + Intronic
1010928066 6:81767643-81767665 CAGGAGGTGGAGAAGAAATGTGG + Intergenic
1011180966 6:84620198-84620220 CAGAAGCTGGAGAAGTGATGGGG - Intergenic
1012769662 6:103415704-103415726 CAGAAGCAGGGAAAGAACTCAGG - Intergenic
1013552785 6:111225455-111225477 CTGAGGCAGGAGAAGAATCCAGG + Intronic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1014026168 6:116648659-116648681 AAGAAGCTGGACAAAAATTACGG + Intronic
1016339622 6:143049181-143049203 CAGATGCAGGACAAGAACTCAGG - Intergenic
1016440479 6:144078259-144078281 CAGCAGCTTGAGAAAAAATCCGG - Intergenic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1017835591 6:158174678-158174700 CAGATGCTGGAGCAGACCTCTGG + Intronic
1018553527 6:165026294-165026316 CAGAAGTTCCAGAAGAACTCTGG + Intergenic
1018834164 6:167470854-167470876 CAGAAGCCTGAGCAGACTTCAGG + Intergenic
1019152699 6:170019359-170019381 AAGAGTCTGGTGAAGAATTCAGG - Intergenic
1019444107 7:1062010-1062032 CACAAACTGGGGAAGAATTGGGG - Intronic
1019943397 7:4308539-4308561 CAGAAGCTGGAGAGGGACCCGGG - Intergenic
1023037335 7:36143630-36143652 CAGAAGCAGGAGAGGAAGTGAGG - Intergenic
1024621127 7:51158691-51158713 GAGGAGCTGGAAAAGAATGCAGG + Intronic
1026425281 7:70285599-70285621 AAGCAGCTGAAGAAGATTTCAGG - Intronic
1026938506 7:74272900-74272922 CAGAGGCTGGAGTAGAGTTTAGG - Intergenic
1027555963 7:79665118-79665140 CAGATGCTTGTGAAGTATTCAGG - Intergenic
1028580406 7:92403945-92403967 CAGAAGGTGCCGAAGACTTCGGG + Intergenic
1029629581 7:101742212-101742234 CATAACCTGGAGAGGAATTCTGG + Intergenic
1030435996 7:109521420-109521442 CAGGAGCAGGAGAAGACTTGAGG - Intergenic
1030761166 7:113353716-113353738 CAGGGGCTGGAGAAGAAGTAGGG - Intergenic
1031712630 7:125068165-125068187 TAGATGCTGGACAAGAATTTGGG - Intergenic
1032248360 7:130232013-130232035 TGGATGCTGGACAAGAATTCAGG - Intergenic
1032541690 7:132708211-132708233 CAGAAACTAGAGGAGAAATCTGG + Intronic
1033209952 7:139453349-139453371 CAGAAGCTGGAGACTAATATTGG + Exonic
1033386509 7:140881799-140881821 CGGAGGCTGGAGAAGAGTTGGGG + Intronic
1034119079 7:148610904-148610926 AAGAAGGTGGAGAAGAATGAGGG - Intronic
1034391875 7:150793477-150793499 CAGATAATGGAGCAGAATTCAGG + Intronic
1035092750 7:156328170-156328192 CAAAAGCTAAAGAAAAATTCAGG + Intergenic
1036138054 8:6180471-6180493 CAGAAGGTGGAGAAGACAGCAGG + Intergenic
1036714776 8:11110648-11110670 AAGAAACTTGAGAAGCATTCTGG - Intronic
1038220917 8:25606748-25606770 CAGAAGTTGTAGTATAATTCAGG + Intergenic
1039166415 8:34686294-34686316 CAGAAACTGTAGAAGAGTTGTGG - Intergenic
1039731281 8:40281286-40281308 CAAAAACTGGAGAAGTTTTCTGG - Intergenic
1041571257 8:59339026-59339048 CAGAAGCAGGATGAGAATTCAGG + Intergenic
1042372841 8:68012018-68012040 CAGAAGATGAAGCAGAAATCAGG - Intronic
1042879915 8:73475803-73475825 CAGAATATGGACTAGAATTCAGG + Intronic
1043473832 8:80586925-80586947 AAGCAGATGGAGAAGAATTAAGG - Intergenic
1046661820 8:116955788-116955810 CAGAAACTAGAGGAGAATTGTGG + Intronic
1046691373 8:117289102-117289124 AAGAAGCTCAAGAAGAATTGGGG + Intergenic
1046721789 8:117628339-117628361 CAGAAGCAGGAGTAGAGTTGGGG + Intergenic
1048949475 8:139483443-139483465 CAGAAGCTGGAGGAAAGTTTGGG + Intergenic
1049019757 8:139947995-139948017 CAGAACGTGGACAAGAATCCAGG - Intronic
1052006219 9:23352223-23352245 CAAAAGCTGGAGATGAATGAAGG - Intergenic
1052170840 9:25394603-25394625 AAGAAGCTGAAGAAGAAATATGG + Intergenic
1052261110 9:26517170-26517192 CCCAAGCAGGAGAAGAGTTCAGG + Intergenic
1053450826 9:38192757-38192779 CAGAGGCTGGGGAAGAAGTGGGG + Intergenic
1053515907 9:38730531-38730553 CAAAAGCTGGAGAACATTTGTGG - Intergenic
1057897214 9:98918937-98918959 CAGAAGCAGGATATGAAATCTGG + Intergenic
1058226397 9:102369836-102369858 CAGAGGCTGGGGAAGAATGGTGG + Intergenic
1058590481 9:106559664-106559686 CAGATGCTGTAGAAGCATTTAGG - Intergenic
1058745821 9:107989623-107989645 CAGAGGCTGGAGAAGAAACCAGG - Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059751709 9:117253751-117253773 CAGGAGCTGGGGCAGAATTGTGG + Intronic
1060070683 9:120544468-120544490 CATAACCTGGAGAAGAAGCCTGG + Intronic
1060819929 9:126655352-126655374 CAGGTGCTGGAGGAGAATGCCGG + Intronic
1061373584 9:130211535-130211557 CAGAAGATGTGGAAGAAATCAGG + Intronic
1185971206 X:4666638-4666660 CAGCAGATGGAGCAGAATTGAGG + Intergenic
1185981995 X:4790200-4790222 GAGCAGCTGGAAAAGAATACTGG - Intergenic
1186526879 X:10257095-10257117 CAGAAGGTGGAAAAGGATTCAGG - Intergenic
1186689519 X:11960225-11960247 CACAAGCTGGAAAGGAAATCTGG - Intergenic
1187401530 X:18964610-18964632 CAGTAGCTGGAACAGAATTCTGG - Intronic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1188002578 X:24996021-24996043 CAGATGCTGGAGGAGCATTTAGG - Exonic
1188829245 X:34876228-34876250 GAGAATATGGAGAAGAATCCAGG + Intergenic
1192224565 X:69219376-69219398 GAGAAGCAGGAAGAGAATTCTGG + Intergenic
1194093257 X:89603638-89603660 CTGAAGCTGGAGAAGCCTCCTGG - Intergenic
1194538925 X:95146177-95146199 CAGAAGCTGGAGGAGGTATCTGG + Intergenic
1194791451 X:98155984-98156006 AATGAGCTGGAGAAGAGTTCTGG - Intergenic
1195539314 X:106044298-106044320 CAGAAGCTGGATAAGAAAAAAGG + Intergenic
1195611543 X:106872620-106872642 CAGAGGGTGAACAAGAATTCTGG - Intronic
1196022258 X:111002751-111002773 CAGCAGCTGCAGTAGAACTCTGG + Intronic
1196177056 X:112650324-112650346 CAGCAGCTGGAGGAGAATGCGGG - Intronic
1196324906 X:114391202-114391224 CAGAAGTTGGAGAAGAAGAGAGG + Intergenic
1199670736 X:150146288-150146310 CAGATGCTGGGGAAGAAGGCAGG - Intergenic
1199887010 X:152030244-152030266 CAGAAGCTGGGGAAACACTCGGG - Intergenic
1200095929 X:153662315-153662337 AAGAAGCTGAAGAAGTCTTCAGG + Intergenic
1200112550 X:153749199-153749221 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1200445889 Y:3259741-3259763 CTGAAGCTGGAGAAGCCTCCTGG - Intergenic
1201621144 Y:15959708-15959730 CAGAAGCTGGAGAGGATGTGGGG + Intergenic