ID: 1016891693

View in Genome Browser
Species Human (GRCh38)
Location 6:149014105-149014127
Sequence CAGAGTGAGGAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016891688_1016891693 -5 Left 1016891688 6:149014087-149014109 CCTGTGGGCCTGGCAGTGCAGAG 0: 1
1: 1
2: 5
3: 87
4: 511
Right 1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016891693 Original CRISPR CAGAGTGAGGAGAAGGAGGC AGG Intronic
No off target data available for this crispr