ID: 1016892761

View in Genome Browser
Species Human (GRCh38)
Location 6:149022772-149022794
Sequence AGGTGGCCCTACCACCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016892752_1016892761 10 Left 1016892752 6:149022739-149022761 CCAGAGAGCCCTGGATCCCGTTG 0: 1
1: 0
2: 1
3: 4
4: 90
Right 1016892761 6:149022772-149022794 AGGTGGCCCTACCACCATCAGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1016892757_1016892761 -6 Left 1016892757 6:149022755-149022777 CCCGTTGCACAAGGTCAAGGTGG 0: 1
1: 0
2: 1
3: 5
4: 120
Right 1016892761 6:149022772-149022794 AGGTGGCCCTACCACCATCAGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1016892755_1016892761 1 Left 1016892755 6:149022748-149022770 CCTGGATCCCGTTGCACAAGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1016892761 6:149022772-149022794 AGGTGGCCCTACCACCATCAGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1016892759_1016892761 -7 Left 1016892759 6:149022756-149022778 CCGTTGCACAAGGTCAAGGTGGC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1016892761 6:149022772-149022794 AGGTGGCCCTACCACCATCAGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1016892751_1016892761 11 Left 1016892751 6:149022738-149022760 CCCAGAGAGCCCTGGATCCCGTT 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1016892761 6:149022772-149022794 AGGTGGCCCTACCACCATCAGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1016892754_1016892761 2 Left 1016892754 6:149022747-149022769 CCCTGGATCCCGTTGCACAAGGT 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1016892761 6:149022772-149022794 AGGTGGCCCTACCACCATCAGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1016892749_1016892761 30 Left 1016892749 6:149022719-149022741 CCAGGGAAACTGGTCTTTGCCCA 0: 1
1: 0
2: 1
3: 16
4: 197
Right 1016892761 6:149022772-149022794 AGGTGGCCCTACCACCATCAGGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016892761 Original CRISPR AGGTGGCCCTACCACCATCA GGG Intronic
902640375 1:17762886-17762908 AGGCAGCCCTACCACCCCCATGG - Intronic
904300362 1:29549982-29550004 TGGTGGTCCTGCCAGCATCAGGG - Intergenic
904457862 1:30658074-30658096 TGGTGGTCCTGCCAGCATCAGGG + Intergenic
905505365 1:38475341-38475363 TGGTGGCATTACCACTATCAGGG + Intergenic
908589223 1:65611508-65611530 AGCTGGCCCTACCACAAACATGG - Intronic
912655355 1:111481782-111481804 AGGTGGCCACAGCACCACCAGGG + Intergenic
920880136 1:209872265-209872287 AGGTGCCCTTAGCACCATCTGGG + Intergenic
924130602 1:240903680-240903702 ATTAGGCCCCACCACCATCATGG - Intronic
1068405310 10:56580976-56580998 CGGAGGCCCTAAGACCATCATGG - Intergenic
1071860892 10:89671499-89671521 ACGTGGCACTACTAACATCATGG + Intergenic
1073542668 10:104325982-104326004 AGGTGGCCCTACCACCGAGCCGG + Intronic
1083392706 11:62366446-62366468 AGGTGGGCCTGCCACCAGCAGGG + Intronic
1083395063 11:62385101-62385123 AGGTGGGCCTGCCACCAGCAGGG + Intronic
1088985814 11:114907105-114907127 GGTTGGCCCTACCACTATCCAGG + Intergenic
1092119880 12:6036436-6036458 AGGTGTCCCTGCTTCCATCAGGG - Exonic
1092138619 12:6167302-6167324 AGGTAGCCCTGCCACCCTCCAGG + Intergenic
1092469867 12:8767994-8768016 AAGTGGCCCTGCCGCCATCTTGG - Intronic
1100194897 12:92234316-92234338 AGTTTGCCCTAGCACCATCTGGG - Intergenic
1106106907 13:26741365-26741387 AACTTGTCCTACCACCATCAGGG + Intergenic
1109134099 13:58625497-58625519 TGGTGGCCCTGCCACCACCATGG - Intergenic
1111352416 13:87048610-87048632 AGGTAACACTACCACCATGATGG - Intergenic
1111931127 13:94514295-94514317 AGGTGGCCAAACCACCAAAACGG + Intergenic
1113259884 13:108550026-108550048 AGCTGGCCCTATCAACATTATGG - Intergenic
1113803411 13:113098129-113098151 AGGCGGCCCTCCCAGCAGCACGG - Intronic
1115521742 14:34239827-34239849 AGATGCCTCTACCACCATCCAGG + Intronic
1116495286 14:45552855-45552877 AGGTGACCCAAGCACCCTCATGG + Intergenic
1120102437 14:80460903-80460925 GGGTATCCCTACCCCCATCAAGG - Intergenic
1122047809 14:99035980-99036002 AGGCGGCCCTCCCACCAGCATGG - Intergenic
1128734537 15:70045601-70045623 AGGTGGCCCCAACCCCAGCATGG - Intergenic
1132204777 15:99978705-99978727 AGGTGCCCCCAACACCAGCAGGG - Intronic
1136778593 16:32884206-32884228 ACGTGGCCATCCCACCAGCAGGG - Intergenic
1136892027 16:33977308-33977330 ACGTGGCCATCCCACCAGCAGGG + Intergenic
1141493640 16:84391694-84391716 ACGTGGCCCTGCCAGCATCTTGG + Intronic
1203081009 16_KI270728v1_random:1146300-1146322 ACGTGGCCATCCCACCAGCAGGG - Intergenic
1145278882 17:21454266-21454288 ATGTGTCCCCACCACCATGATGG - Intergenic
1150425428 17:65073572-65073594 AGCTGTCCCTGCCCCCATCATGG - Intergenic
1155150382 18:23118218-23118240 ATGTGGCCCTGCCACCTTCCTGG - Intergenic
1156897237 18:42259667-42259689 TAGGGGCCCTACCAGCATCAAGG + Intergenic
1163408016 19:17135748-17135770 AGGGGCCCCTCCCACCACCATGG - Intronic
1166976536 19:46608234-46608256 AGATGGCACTATCACCACCAAGG + Exonic
925341601 2:3141788-3141810 AGGAGGCCATGCCACCATCCAGG - Intergenic
926864041 2:17339638-17339660 AAGTGGCCCCACCACCATCTTGG + Intergenic
927639676 2:24838660-24838682 AGGTGGCCCTCACACCCCCAGGG + Intronic
931534280 2:63255400-63255422 ATGAGGCCCTACCTCCAACATGG - Intronic
938187072 2:129240965-129240987 AGCTGGGCCTGCCACCACCATGG - Intergenic
1170160338 20:13304021-13304043 TTGTGGCTCTGCCACCATCAAGG + Intergenic
1170365342 20:15592020-15592042 AGGAGGCTCTTCCACCATCTCGG + Intronic
1171265624 20:23769760-23769782 ACAAGGCCCTACCACCATCTTGG + Intergenic
1175109306 20:56635328-56635350 AGGGGGCCCCTCCACCATCTGGG + Intronic
1175321743 20:58093038-58093060 CGGTGGCCCTCTCACCACCATGG + Intergenic
1179486983 21:41716756-41716778 AGGAGCCCCTTCCCCCATCAGGG + Intergenic
1179608181 21:42531901-42531923 AGGTGACCTTTCCAACATCAAGG + Intronic
1183529195 22:38343603-38343625 AGGTGGCACCACCACCATTTTGG - Intronic
1183793489 22:40095336-40095358 AAATGGCCTTGCCACCATCAAGG - Intronic
950143047 3:10628317-10628339 AGGTGGCCATGCCACCATCCAGG + Intronic
950539278 3:13600318-13600340 GGGTGGCCCTCCCAGCATAAGGG + Intronic
954653982 3:52182685-52182707 AGGTTGCCCCACCAACATCTGGG + Intergenic
962342090 3:134594334-134594356 AGCTGCCCCTGCCACCATAAAGG + Intergenic
963730445 3:148966068-148966090 AGCTGGCCCTACCTCCAGCTGGG + Intergenic
968858275 4:3145665-3145687 AGATGGCCCTACTAGCATCTGGG + Intronic
980633366 4:135467826-135467848 AGGTGTAATTACCACCATCATGG + Intergenic
989427215 5:41310470-41310492 AGGTGTATCTACCACCATCTTGG + Exonic
993334224 5:86637089-86637111 TTGTGGTACTACCACCATCACGG + Intergenic
993458833 5:88158539-88158561 AGGCCCCCCTACCACCAGCATGG - Intergenic
997521873 5:134528166-134528188 AGGCGGCCCTACCACCTCCCAGG - Intronic
1003195019 6:3906640-3906662 AGGTGGCCCTGCCTGCATCCTGG - Intergenic
1012258450 6:97060732-97060754 AGGTGGCCCAATCACCCTCCTGG - Intronic
1016892761 6:149022772-149022794 AGGTGGCCCTACCACCATCAGGG + Intronic
1018485591 6:164238187-164238209 AGGTGGAACTTCCACCATGAGGG + Intergenic
1021784739 7:24140706-24140728 AGGTGGCCCTTGCACCCACATGG + Intergenic
1022834879 7:34103855-34103877 AGGTGGCCCTTGCACCTCCAGGG - Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1047861623 8:128973254-128973276 AGGTGGCATGTCCACCATCAAGG - Intergenic
1048109556 8:131453421-131453443 AGGAGACCCTACAACCTTCATGG + Intergenic
1053543037 9:38994182-38994204 AGGAGACCCTACAACCACCAGGG - Intergenic
1053807477 9:41817699-41817721 AGGAGACCCTACAACCACCAGGG - Intergenic
1054623115 9:67369728-67369750 AGGAGACCCTACAACCACCAGGG + Intergenic
1056756992 9:89388090-89388112 AGCTGTCCCTGACACCATCATGG - Intronic
1189981422 X:46514550-46514572 AAGTGGCCCTTCCTGCATCAAGG + Intronic
1195823410 X:108970971-108970993 AGGGGGCCTCACCACCATGAAGG + Intergenic
1199849625 X:151716125-151716147 AGGAGGCCCTCCCAACACCAAGG + Exonic
1200141777 X:153906135-153906157 AGGTGCCACGAACACCATCAGGG - Exonic
1200151294 X:153952646-153952668 AGCTGGCACCACCACCCTCATGG - Exonic