ID: 1016893910

View in Genome Browser
Species Human (GRCh38)
Location 6:149034070-149034092
Sequence TCCTCTCCATCTTCCTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016893907_1016893910 4 Left 1016893907 6:149034043-149034065 CCATTACCTTTACTTCTACTTCC 0: 1
1: 0
2: 0
3: 28
4: 495
Right 1016893910 6:149034070-149034092 TCCTCTCCATCTTCCTAAGATGG No data
1016893908_1016893910 -2 Left 1016893908 6:149034049-149034071 CCTTTACTTCTACTTCCTTGCTC 0: 1
1: 0
2: 3
3: 32
4: 431
Right 1016893910 6:149034070-149034092 TCCTCTCCATCTTCCTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016893910 Original CRISPR TCCTCTCCATCTTCCTAAGA TGG Intronic
No off target data available for this crispr