ID: 1016894971

View in Genome Browser
Species Human (GRCh38)
Location 6:149042563-149042585
Sequence GGTCACTCCACTTCAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016894967_1016894971 -4 Left 1016894967 6:149042544-149042566 CCAGCAGGGCCCTGAGGCAGGTC 0: 1
1: 1
2: 6
3: 43
4: 345
Right 1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG No data
1016894964_1016894971 3 Left 1016894964 6:149042537-149042559 CCGTGGTCCAGCAGGGCCCTGAG 0: 1
1: 0
2: 4
3: 35
4: 340
Right 1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG No data
1016894963_1016894971 4 Left 1016894963 6:149042536-149042558 CCCGTGGTCCAGCAGGGCCCTGA 0: 1
1: 0
2: 4
3: 22
4: 260
Right 1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG No data
1016894957_1016894971 15 Left 1016894957 6:149042525-149042547 CCACCCTGCCACCCGTGGTCCAG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG No data
1016894958_1016894971 12 Left 1016894958 6:149042528-149042550 CCCTGCCACCCGTGGTCCAGCAG 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG No data
1016894962_1016894971 7 Left 1016894962 6:149042533-149042555 CCACCCGTGGTCCAGCAGGGCCC 0: 1
1: 0
2: 0
3: 23
4: 198
Right 1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG No data
1016894959_1016894971 11 Left 1016894959 6:149042529-149042551 CCTGCCACCCGTGGTCCAGCAGG 0: 1
1: 1
2: 3
3: 14
4: 229
Right 1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016894971 Original CRISPR GGTCACTCCACTTCAAAGGA AGG Intronic
No off target data available for this crispr