ID: 1016899893

View in Genome Browser
Species Human (GRCh38)
Location 6:149091010-149091032
Sequence TGGCCTGGCCAGGAACTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016899887_1016899893 -5 Left 1016899887 6:149090992-149091014 CCCATCCTCAGTTCTCCTTGGCC No data
Right 1016899893 6:149091010-149091032 TGGCCTGGCCAGGAACTGCTAGG No data
1016899890_1016899893 -10 Left 1016899890 6:149090997-149091019 CCTCAGTTCTCCTTGGCCTGGCC No data
Right 1016899893 6:149091010-149091032 TGGCCTGGCCAGGAACTGCTAGG No data
1016899888_1016899893 -6 Left 1016899888 6:149090993-149091015 CCATCCTCAGTTCTCCTTGGCCT No data
Right 1016899893 6:149091010-149091032 TGGCCTGGCCAGGAACTGCTAGG No data
1016899883_1016899893 8 Left 1016899883 6:149090979-149091001 CCCTCTGCATCCTCCCATCCTCA No data
Right 1016899893 6:149091010-149091032 TGGCCTGGCCAGGAACTGCTAGG No data
1016899884_1016899893 7 Left 1016899884 6:149090980-149091002 CCTCTGCATCCTCCCATCCTCAG No data
Right 1016899893 6:149091010-149091032 TGGCCTGGCCAGGAACTGCTAGG No data
1016899885_1016899893 -2 Left 1016899885 6:149090989-149091011 CCTCCCATCCTCAGTTCTCCTTG No data
Right 1016899893 6:149091010-149091032 TGGCCTGGCCAGGAACTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016899893 Original CRISPR TGGCCTGGCCAGGAACTGCT AGG Intergenic
No off target data available for this crispr