ID: 1016899901

View in Genome Browser
Species Human (GRCh38)
Location 6:149091077-149091099
Sequence CTATCAAGACAGATGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016899897_1016899901 17 Left 1016899897 6:149091037-149091059 CCATCATTTTGATTTAGAATAAA No data
Right 1016899901 6:149091077-149091099 CTATCAAGACAGATGGAGTAAGG No data
1016899896_1016899901 18 Left 1016899896 6:149091036-149091058 CCCATCATTTTGATTTAGAATAA No data
Right 1016899901 6:149091077-149091099 CTATCAAGACAGATGGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016899901 Original CRISPR CTATCAAGACAGATGGAGTA AGG Intergenic
No off target data available for this crispr