ID: 1016903262

View in Genome Browser
Species Human (GRCh38)
Location 6:149123107-149123129
Sequence TCTTATCAGGGCATGGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016903262_1016903266 27 Left 1016903262 6:149123107-149123129 CCATAAACCATGCCCTGATAAGA No data
Right 1016903266 6:149123157-149123179 GTTCTGACTGCTCCACCAGCTGG 0: 5
1: 61
2: 139
3: 272
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016903262 Original CRISPR TCTTATCAGGGCATGGTTTA TGG (reversed) Intergenic
No off target data available for this crispr