ID: 1016904310

View in Genome Browser
Species Human (GRCh38)
Location 6:149133753-149133775
Sequence ATGGAGGATGAGGATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016904310_1016904317 30 Left 1016904310 6:149133753-149133775 CCATCCTCATCCTCATCCTCCAT No data
Right 1016904317 6:149133806-149133828 CACTTTCTTCCATGAGAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016904310 Original CRISPR ATGGAGGATGAGGATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr