ID: 1016916497

View in Genome Browser
Species Human (GRCh38)
Location 6:149248823-149248845
Sequence GACAAGACAGAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 465}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016916497_1016916500 5 Left 1016916497 6:149248823-149248845 CCTGCCATTTTCTCTGTCTTGTC 0: 1
1: 1
2: 4
3: 44
4: 465
Right 1016916500 6:149248851-149248873 AGCAGTCATGTCCCCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016916497 Original CRISPR GACAAGACAGAGAAAATGGC AGG (reversed) Intronic
900306941 1:2015058-2015080 CACCAAACAGAGAAAATGGCAGG - Intergenic
900430209 1:2597806-2597828 GACAGGAAGGAGAAGATGGCAGG - Intronic
901386444 1:8912346-8912368 GAAAAGACTGAGAAATTGGATGG + Intergenic
901403157 1:9028268-9028290 GACAAGACTGAGAGAATGAAAGG + Intergenic
901555771 1:10030157-10030179 GAAAAGAAAGAGAAAAAGCCGGG + Intergenic
901770202 1:11526297-11526319 GACAAGACAGGATAAATGGCAGG - Intronic
902179907 1:14679974-14679996 GACAAGAGGGAGAAGGTGGCTGG + Intronic
904397875 1:30234795-30234817 CAGAAGTCAGAGAAAATGGATGG + Intergenic
905251836 1:36654268-36654290 TTCCAGACAGAGGAAATGGCAGG - Intergenic
905358996 1:37405353-37405375 CACTAGGCAGAGAAAAAGGCTGG + Intergenic
905489590 1:38333150-38333172 GACAAGAGTGAGAAGATGGGTGG - Intergenic
905958667 1:42023646-42023668 AGCAAGAGAGAGAGAATGGCGGG - Intronic
906011825 1:42534203-42534225 GAAAAGACAAAGAAAATGAGGGG + Intronic
906076076 1:43053159-43053181 GGCAAGACAGAAGGAATGGCAGG - Intergenic
908518413 1:64916958-64916980 GAAAAGACAAAGAAAGTGGAGGG + Intronic
910165540 1:84324020-84324042 GACCAGACATAGAGAATGGAGGG - Intronic
910629238 1:89339351-89339373 AACAAGAGAGAGAAACTGGAGGG - Intergenic
911221147 1:95248843-95248865 AATAAGACAGTGAAAATTGCTGG + Intergenic
913168103 1:116208142-116208164 GAAAAGAGAGAGAAAATGGATGG - Intergenic
913264556 1:117031585-117031607 GAACAGACAGAGAACAGGGCTGG - Intronic
915541932 1:156572787-156572809 GAGATGACAGAGGCAATGGCAGG - Intergenic
916361268 1:163972004-163972026 AACAAGACAGTAAAACTGGCAGG + Intergenic
916551175 1:165851134-165851156 GACAAGACAGAGATAACAGGGGG - Intronic
918139643 1:181709572-181709594 GACATGACAGAGAAACTGGCAGG + Intronic
918682796 1:187376010-187376032 AATAAGACATAGAAAGTGGCTGG - Intergenic
919306015 1:195838760-195838782 GATAAAACTGAGGAAATGGCCGG + Intergenic
919721533 1:200842250-200842272 GAGAAGAAAAAGAAAATGGAGGG + Intronic
920081797 1:203380119-203380141 CACCAGACAGGGAAAATGGCAGG + Intergenic
920266256 1:204725635-204725657 GGCCAGAAAGAGAAAATGACAGG - Intergenic
922580670 1:226695596-226695618 GAGAAGAGAGAGAGGATGGCGGG - Intronic
923458168 1:234184516-234184538 GACAAAAAAGACAAAATGTCAGG - Intronic
924519124 1:244790992-244791014 ATCAAGAAAGTGAAAATGGCTGG + Intergenic
924593276 1:245423306-245423328 CATAAAACAGAGAAAATGGTAGG - Intronic
1062887049 10:1024552-1024574 AACTGGACAGAGAAAATGGGCGG + Intronic
1062903817 10:1166347-1166369 GAGAAGACAGCGGGAATGGCGGG + Intergenic
1063647549 10:7900202-7900224 GAAATAACAGAGAAAATGGTAGG - Intronic
1063774200 10:9242272-9242294 AAGAAAACAGAGAAAATGGATGG - Intergenic
1063897854 10:10701144-10701166 GCCCAGCCAGAGAAAATGGCAGG + Intergenic
1063914490 10:10867729-10867751 GAGAAGACAAAGAACATGACTGG - Intergenic
1063917315 10:10896585-10896607 GACAACACACAGAAAAGGACAGG + Intergenic
1065204715 10:23345481-23345503 TACAAGACAGAGAAGAGGCCGGG - Intergenic
1065290349 10:24223392-24223414 GACAGGAAAGAGGAAATGGGTGG - Intronic
1066636063 10:37502127-37502149 ACCAAGACAGATAAAATGGTAGG - Intergenic
1066644303 10:37589967-37589989 TTGAAGACAGAGAAAATGACAGG - Intergenic
1067900345 10:50233934-50233956 GGCAAGACAGAGAAAATAAAAGG - Intronic
1067921329 10:50460977-50460999 GAAAAGAAAGAAAAAATGGGAGG - Intronic
1069309945 10:67022499-67022521 GAGATGACAAAGGAAATGGCAGG + Intronic
1070470831 10:76777661-76777683 GAGAAGACTGAGAAAATGGAAGG - Intergenic
1070587598 10:77778669-77778691 GACCAGAAAGATAAAAGGGCTGG - Intergenic
1070840569 10:79484576-79484598 CACCAGGCAGAGAAAAGGGCAGG + Intergenic
1071049247 10:81426819-81426841 GAAAAGACAGACAAAATGGAAGG - Intergenic
1073666528 10:105540354-105540376 GAAAAGACAGAGAAAGGGCCTGG + Intergenic
1074369327 10:112886891-112886913 GGGAAGACAGAGAAAGGGGCTGG - Intergenic
1075170672 10:120110968-120110990 GAAAAGAAAAAGAAACTGGCTGG - Intergenic
1075480708 10:122779672-122779694 GACAATAGAGAGGAAAGGGCTGG - Intergenic
1076546828 10:131251020-131251042 GACAAGCCGGAGAATTTGGCTGG - Intronic
1077937089 11:6799817-6799839 TACAAGAGAGAAAAAAAGGCTGG + Intergenic
1078098517 11:8314952-8314974 GGCAAGGCAGAGAAAAGGGAAGG - Intergenic
1078336699 11:10469699-10469721 GACACAACAGAGAAAATTTCAGG + Intronic
1078369622 11:10734197-10734219 TATAAGAAACAGAAAATGGCCGG + Intergenic
1078570830 11:12456661-12456683 AACAAGACATACAAAAGGGCTGG - Intronic
1078777007 11:14403044-14403066 GAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1079005624 11:16789586-16789608 GACAGGCCAGAGAGAAAGGCAGG + Intronic
1079049632 11:17142625-17142647 GACAACACAGAGAAATCTGCAGG + Intronic
1079389436 11:20008393-20008415 GAAAAGACAGAGAAGATGACAGG - Intronic
1079932102 11:26577265-26577287 AAAAAGAGAGAGAAAGTGGCTGG + Intronic
1079941259 11:26683688-26683710 GAGAGGAGAGAGAAAACGGCTGG + Intronic
1080262764 11:30367479-30367501 GAAAAGAGAGAGAAACTAGCTGG - Intergenic
1080399182 11:31918234-31918256 GTGAAGACAGATACAATGGCAGG + Intronic
1081790638 11:45781280-45781302 TACAATACAGTCAAAATGGCAGG - Intergenic
1082047517 11:47742176-47742198 TAAAGGACAGAGAAAATAGCTGG + Intronic
1082277314 11:50235931-50235953 GATAATACATACAAAATGGCAGG - Intergenic
1083012909 11:59421213-59421235 GAGAGGAGAGAGAAAGTGGCAGG + Intergenic
1083163486 11:60869669-60869691 GTTGAGACAGAGAACATGGCGGG - Exonic
1085482339 11:76833115-76833137 GACAAGACAGAGAGGAGGGCTGG - Intergenic
1085565119 11:77506640-77506662 GACAATACAGGAAAAATGGTGGG + Intergenic
1086344898 11:85886346-85886368 GAGAATGCAGAGAAAATGTCAGG + Exonic
1086842759 11:91707895-91707917 GTGAAGACAGAGAAAATGTCAGG - Intergenic
1088924813 11:114290780-114290802 GACAAAATAGAGAAAGTAGCGGG - Intronic
1089213698 11:116822886-116822908 GCTCAGACAGGGAAAATGGCAGG - Intronic
1089897294 11:121943601-121943623 GTCAAGACAGTGACCATGGCCGG - Intergenic
1090173565 11:124626487-124626509 TGCAAGAAAAAGAAAATGGCGGG + Exonic
1090442187 11:126733687-126733709 GTCAAGACACAGAAAGGGGCAGG - Intronic
1091598511 12:1899532-1899554 GAAAAGTCAGATAAAATGGATGG + Intronic
1091651562 12:2314033-2314055 GATAAGACAGAGGAAAGGGCTGG - Intronic
1091877778 12:3950683-3950705 GAAGAGACAGGGAGAATGGCAGG - Intergenic
1092067355 12:5602579-5602601 GAGAAGACAGAGACAATGGTGGG + Intronic
1092299001 12:7227304-7227326 GATAAGAATGAGAAAATGGTGGG + Intergenic
1093006710 12:14059173-14059195 GACAAGTCAGAGACATTGGCAGG + Intergenic
1093975839 12:25421056-25421078 GACAAGACAGAGCCACTTGCAGG + Intronic
1094281147 12:28740050-28740072 GGCAGGAGAGAGAAAATGGGAGG - Intergenic
1094499531 12:31009634-31009656 TACAAGCCAGAGCAGATGGCAGG + Intergenic
1094540259 12:31357446-31357468 GAAAAGAAAAAAAAAATGGCCGG - Intergenic
1095639410 12:44469777-44469799 GACAAGACAGAGAAAAGTAATGG - Intergenic
1095871568 12:47034127-47034149 AACAAAACAGAGAAAAGGGCAGG - Intergenic
1098321371 12:69247228-69247250 GCCAAGCCAGAGAAAATGGATGG - Intronic
1099550859 12:84042161-84042183 GGGCAGACAGAGAAAAAGGCTGG - Intergenic
1100116633 12:91313483-91313505 GAAATGAGAGAGAAAGTGGCTGG + Intergenic
1100328364 12:93563110-93563132 GAAAAGCCAGATAAATTGGCAGG + Intergenic
1102371614 12:112386500-112386522 AGCAAGACAAAGAAAATGCCTGG + Intergenic
1102553895 12:113713104-113713126 GACAAGACAGACAAAAATCCAGG + Intergenic
1103175393 12:118858961-118858983 AACAAGACAGAGGGAAAGGCAGG + Intergenic
1103185175 12:118950673-118950695 TAAAAGACAGAGAAAAGGGATGG - Intergenic
1103598228 12:122037253-122037275 GTCAAGAGATAGAAAAAGGCAGG - Intronic
1106007402 13:25783736-25783758 GAACAGACAGAGAACATGGATGG - Intronic
1106576241 13:30978558-30978580 CACAAGAAAAAAAAAATGGCAGG - Intergenic
1107664024 13:42670599-42670621 CACAAGACAGAAATTATGGCAGG - Intergenic
1108685057 13:52812350-52812372 GAAAAGAAAAAGAAAATTGCCGG - Intergenic
1109971819 13:69780102-69780124 GATAAAATAGAAAAAATGGCTGG - Intronic
1110480664 13:75971705-75971727 GACAATTCAGAGAAATTGGTAGG - Intergenic
1111041075 13:82748905-82748927 AACATGACAGAGAAAAGGCCAGG - Intergenic
1112439249 13:99413957-99413979 GCCCAGACAGAGGAGATGGCAGG - Intergenic
1112867525 13:103924185-103924207 GACTAGTGAGAGAAAATAGCTGG - Intergenic
1113142819 13:107174151-107174173 GGCAACACAGAGAAAATGGAGGG - Intronic
1113826412 13:113257999-113258021 AACAAAACAAAAAAAATGGCTGG - Intronic
1114033395 14:18596453-18596475 GACAAGAAAGAGAAAGGTGCAGG + Intergenic
1114078189 14:19175652-19175674 GACAAGAAAGAGAAAGGTGCAGG + Intergenic
1114125305 14:19718900-19718922 GACAAGAAAGAGAAAGGTGCAGG - Intergenic
1114171848 14:20280491-20280513 GTCAAGCCTGAGCAAATGGCAGG - Intronic
1114504421 14:23198161-23198183 GACAAGACATATAAGAAGGCAGG - Intronic
1115876121 14:37864133-37864155 TACAAGACAGAGGTAAAGGCTGG + Intronic
1116631286 14:47337673-47337695 GACAATAAAGAGAAAATGGGGGG + Intronic
1116721266 14:48498675-48498697 CACAAGACAAAGAAAATGGGAGG + Intergenic
1117487378 14:56212104-56212126 AGCAAGACAGTGAAAATAGCTGG + Intronic
1117827876 14:59722444-59722466 GACAACACAGAGGAACTGGAAGG + Intronic
1118300271 14:64608948-64608970 GTCAAGACATAGGACATGGCAGG + Intergenic
1118379210 14:65204200-65204222 TACAAGTAAGAGAAAATGGCTGG - Intergenic
1118848573 14:69567251-69567273 GACAAGAAAGTCAAAATTGCAGG - Intergenic
1120461125 14:84796994-84797016 GAAAAGACAGAGAAAGTCACGGG - Intergenic
1120683811 14:87513707-87513729 GAGAAAACAGAGGAAATGGAGGG + Intergenic
1121736273 14:96220239-96220261 GGCAAGTCAGAGGAAATGCCGGG + Intronic
1122422973 14:101589077-101589099 CCCAAGTCAGAGAAAATGACTGG + Intergenic
1123057207 14:105576198-105576220 GCCAAGACAGGCAAGATGGCGGG - Intergenic
1123081038 14:105695693-105695715 GCCAAGACAGGCAAGATGGCGGG + Intergenic
1202941138 14_KI270725v1_random:147145-147167 CCCAAGACACAGAAAAAGGCAGG - Intergenic
1123568733 15:21579796-21579818 GACAAGAAAGAGAGAACTGCAGG - Intergenic
1123604842 15:22015117-22015139 GACAAGAAAGAGAGAACTGCAGG - Intergenic
1123875646 15:24621531-24621553 GACAGGACAGAGAACAAAGCTGG - Intergenic
1124081650 15:26504330-26504352 GGAAAGAGAGAGAAAATGACTGG - Intergenic
1124865168 15:33483181-33483203 GAGAAGAGAGAGATAATGGAAGG - Intronic
1124881795 15:33649551-33649573 AACAAGACAGAGAAAATCTCTGG + Intronic
1125431431 15:39598568-39598590 GATAAGACAGAAAAAGTGACTGG + Exonic
1126130331 15:45334832-45334854 GAAAAGAAAGAAAAAAGGGCTGG + Intergenic
1126400608 15:48265618-48265640 GAAAAGATAGAGAGATTGGCAGG - Intronic
1127451551 15:59121633-59121655 AAAAAAACAGAGAAACTGGCTGG + Intronic
1127628879 15:60806803-60806825 GACAAAAAGGAGAAAAAGGCAGG + Intronic
1128125872 15:65192472-65192494 AAGAAGAGAGAGAAATTGGCCGG + Intergenic
1128151573 15:65366590-65366612 GAGAAGAGAGAGAGAAGGGCGGG + Intronic
1128437706 15:67671237-67671259 GAAAAGAAAGAGAAAAGGGAGGG + Intronic
1128934164 15:71731311-71731333 GTCAACACAGAGAAAATTGAGGG + Intronic
1130119657 15:81036776-81036798 GACAAGCCAGAGACCATGGATGG - Intronic
1130187273 15:81696525-81696547 GACAAGAGAGGGAAGATGCCAGG + Intergenic
1131699621 15:94920095-94920117 GGGAAGACAGAGAATATGTCTGG + Intergenic
1202977088 15_KI270727v1_random:306886-306908 GACAAGAAAGAGAGAACTGCAGG - Intergenic
1132628182 16:902294-902316 GACAAGTCAGGGAGAATGCCAGG - Intronic
1133320432 16:4910211-4910233 GAGAAGAGAGATAAAATAGCTGG - Intronic
1133409787 16:5558667-5558689 CACAAGACTGAGACGATGGCAGG - Intergenic
1133442343 16:5831314-5831336 AGCAAGATAGAGAGAATGGCAGG - Intergenic
1134469238 16:14508227-14508249 GATAAGACAGACAAATAGGCAGG + Intronic
1134902539 16:17951529-17951551 TACAAGACAGAGAGTATGTCTGG - Intergenic
1135068158 16:19329113-19329135 GAAAAGAGAGAGAAAGGGGCAGG - Intergenic
1135717618 16:24785853-24785875 GAAAAGACAGTGACAAGGGCTGG + Intronic
1137683327 16:50369170-50369192 GACAAGACAGACAAATTGAGGGG - Intergenic
1138984189 16:62306835-62306857 GACAGGGCAGAGAAATTGACAGG - Intergenic
1139376723 16:66503310-66503332 AACAAGGAAGAGAACATGGCAGG - Intronic
1139413892 16:66790217-66790239 GAAAAGACAGGGAAAAGGGAAGG + Intronic
1139658551 16:68404484-68404506 GATAAAACAGAGAAAACAGCTGG - Intronic
1141199123 16:81883597-81883619 GAGAAGACTGAGAAGATGGCAGG + Intronic
1142034805 16:87856358-87856380 GACAGCACAGAGGAAGTGGCCGG + Intronic
1142249154 16:88983222-88983244 GGGAACACAGAGGAAATGGCCGG + Intergenic
1203141230 16_KI270728v1_random:1768136-1768158 GAAAAATCAGAGAAAGTGGCAGG + Intergenic
1143149348 17:4797865-4797887 GGAAAGAAAAAGAAAATGGCTGG - Intronic
1143239817 17:5434447-5434469 AAAAAGAGAGAGAGAATGGCAGG - Intronic
1143386874 17:6536191-6536213 GAGAGGACAGAGACAATGGAGGG + Intronic
1143638644 17:8182234-8182256 GACAAAATAAAGAAAATAGCCGG + Intergenic
1143870291 17:9953367-9953389 GAGAGGACAGAGACAGTGGCAGG - Intronic
1144243186 17:13334584-13334606 GACAAGACAGAGACAGTTGGGGG + Intergenic
1145061075 17:19734272-19734294 GACAAGACAAAGACTAAGGCAGG + Intergenic
1145855031 17:28147121-28147143 GACAAGACTGAGAAAAAAGATGG - Intronic
1146282754 17:31555796-31555818 GACCAGAGGGAGAAAAGGGCTGG - Intergenic
1146719293 17:35112370-35112392 AACAAAACAAACAAAATGGCTGG - Intronic
1147322074 17:39652672-39652694 AGCAAGACAGAGAGAAGGGCTGG + Intronic
1148807785 17:50272989-50273011 TATAAGACAGAGAACATGACTGG + Intronic
1148905859 17:50911745-50911767 GAGAAGACAGAATAATTGGCTGG + Intergenic
1149259309 17:54861606-54861628 GATAAGACTGAGAAGATGGGCGG - Intergenic
1149635861 17:58168763-58168785 GACAAGAGGGAGAAAAGGGAGGG - Intergenic
1150657196 17:67046989-67047011 GAAAAGAGAGGGAAAAAGGCAGG - Intronic
1151165123 17:72196859-72196881 TCAAAGCCAGAGAAAATGGCAGG + Intergenic
1151423229 17:74012608-74012630 GACATGACAGAGAAAAGGGGTGG + Intergenic
1151795135 17:76339541-76339563 TAAGAGACAGAGAAAATGCCAGG + Intronic
1151880904 17:76893836-76893858 GCCAAGACCGAGCAAAAGGCTGG - Intronic
1152773234 17:82183622-82183644 AACAAGACAGATAGAATGTCTGG - Intronic
1153638797 18:7136881-7136903 AACAATACAAAAAAAATGGCCGG - Intergenic
1154191365 18:12233560-12233582 GTCAGGTCAGAGAAAATAGCAGG - Intergenic
1155214486 18:23631037-23631059 GACAAGAAAGAGAAAAGGGTAGG - Intronic
1157115976 18:44863201-44863223 GTCAAGACAGAGAAAAGGAAAGG - Intronic
1157827266 18:50823470-50823492 AACAAAATAGAGAAAATGGAAGG - Intronic
1158725475 18:59967995-59968017 GTAAAGACAGAGACATTGGCGGG - Intergenic
1158817674 18:61122342-61122364 GACAAGATAGAGAAGCTGGAGGG - Intergenic
1159144347 18:64434220-64434242 GAGAAGACAGAGAAAAGATCAGG + Intergenic
1159157790 18:64606771-64606793 GAGAAAAATGAGAAAATGGCTGG + Intergenic
1159297705 18:66517688-66517710 AAACAGCCAGAGAAAATGGCAGG - Intronic
1161395722 19:4043990-4044012 GGCAAGACAGAGAGAATGAAAGG - Intergenic
1161638514 19:5404689-5404711 GACAAGACAGAGATAGAGACAGG - Intergenic
1161797303 19:6394442-6394464 GACAAGAACGAGTAAACGGCTGG + Intergenic
1163447224 19:17353726-17353748 GGCGAGACAGAGAAAGGGGCAGG - Intronic
1165124950 19:33587538-33587560 CACATGACTGAGAACATGGCTGG + Intergenic
1165945324 19:39438198-39438220 GACAAAAAAGAGATAAAGGCAGG + Intronic
1166073235 19:40398511-40398533 GACAAGACAGAGGGCAAGGCTGG + Intronic
1166103148 19:40583239-40583261 AACAAGACAGGGACAAAGGCAGG + Intronic
1166287969 19:41844148-41844170 GCCAAGGCAGAGAAGATGGCGGG + Exonic
1166804970 19:45480652-45480674 AAATAGACACAGAAAATGGCAGG - Intergenic
1167194279 19:48016438-48016460 GAAAAGAAAGAGAAAAGGGAGGG - Intronic
1167708141 19:51093942-51093964 TGCAAGGCAGAGAGAATGGCAGG - Intergenic
1167836393 19:52075255-52075277 AACAAGACAGAGAAAAACACAGG + Intronic
925196708 2:1931640-1931662 AACAACACACACAAAATGGCTGG - Intronic
925677244 2:6376082-6376104 AAAAAGAAAAAGAAAATGGCTGG - Intergenic
926708076 2:15850658-15850680 GACAATGCATAGAAAATGACTGG - Intergenic
928172837 2:29014453-29014475 GAGCAGACTGAGAAAAAGGCAGG - Exonic
928400798 2:30977385-30977407 TAAAAGACAGAGAGAAGGGCTGG - Intronic
928733144 2:34256162-34256184 AAGATGAAAGAGAAAATGGCAGG - Intergenic
931074954 2:58700387-58700409 GATAAGAGAGATAAAATAGCAGG - Intergenic
932133794 2:69211037-69211059 GACAAGCCAGAGGCAAGGGCTGG + Intronic
932323459 2:70838602-70838624 GAAAAGACAGAGAAGCAGGCAGG + Intergenic
932640315 2:73439414-73439436 TAAAAGACAGATAAAAAGGCCGG - Intronic
933164981 2:79065800-79065822 AGTAAGACAGAGAAAGTGGCTGG - Intergenic
933872915 2:86587451-86587473 GAAAAGACATGGAAGATGGCTGG + Intronic
934075634 2:88426535-88426557 TAAAAGACAGAGAAAAGGCCGGG + Intergenic
935468813 2:103432315-103432337 GTAAAGAAAGAGAAATTGGCCGG + Intergenic
937103413 2:119289074-119289096 GAGAATACAGAGAGAATTGCTGG + Intergenic
937250923 2:120523133-120523155 AACATTGCAGAGAAAATGGCTGG + Intergenic
937438548 2:121898298-121898320 GACTAGACAGAGAGGATGACAGG - Intergenic
937485239 2:122308704-122308726 GAGAATACAGAGAGAAAGGCAGG + Intergenic
937525025 2:122758147-122758169 AAGTACACAGAGAAAATGGCGGG - Intergenic
938094759 2:128454238-128454260 GACTAGACAGGGCTAATGGCTGG - Intergenic
940755280 2:157674979-157675001 GAAAAGACAGAGAAAATGAAGGG + Intergenic
940876596 2:158903793-158903815 CAAAAGACAGAGCAAATGGCTGG + Intergenic
943987093 2:194637123-194637145 GACTGGACAAAGAAAATGACAGG + Intergenic
944378901 2:199083291-199083313 AAAAAGACAGAGAAAATGGCAGG + Intergenic
945860502 2:215115933-215115955 GACAGGACAGAGGCAGTGGCAGG + Intronic
946746272 2:222848830-222848852 AACAAAACAGAGAGAATGGGAGG + Intergenic
947969834 2:234313694-234313716 GAAAAGAAAGAGAAAAGGGCAGG - Intergenic
948782130 2:240328388-240328410 GAAATCACAGAGAAAATGGCTGG - Intergenic
1170961598 20:21030135-21030157 GTCAAGACAGTCTAAATGGCTGG + Intergenic
1171101313 20:22385871-22385893 AACAGGGCAGAGAAAAAGGCGGG - Intergenic
1171200882 20:23241415-23241437 GACCAGCCTGAGCAAATGGCTGG - Intergenic
1171219583 20:23382852-23382874 GAGGAGAAAGAGAAAAGGGCTGG + Intronic
1172979086 20:38927476-38927498 GACAAGAAAGAAAAAGCGGCAGG - Intronic
1173351401 20:42248753-42248775 GACAACACCGTGAAGATGGCTGG - Exonic
1173418235 20:42877520-42877542 GAAATGAAAGAGAAAAGGGCAGG + Intronic
1173678449 20:44858537-44858559 GAAAAGACAGAGAAAATATGAGG + Intergenic
1173903767 20:46610842-46610864 GGCAAGAAAGAGAAAACGTCAGG - Intronic
1173903914 20:46612051-46612073 AAAAAGAAAGAGAAAATGTCAGG - Intronic
1174686520 20:52461259-52461281 GACAGGAAGGAGAAAATGGAAGG - Intergenic
1175071998 20:56342844-56342866 AACAAGAGAGAGTAAATGGTTGG - Intergenic
1175383896 20:58582027-58582049 GACAAGACAGAGAGAGAGGGGGG + Intergenic
1176007288 20:62873060-62873082 GAGAAGAGAGAGGAGATGGCGGG + Intergenic
1176167853 20:63683412-63683434 GTCTTGACAGTGAAAATGGCTGG + Intronic
1176582023 21:8539797-8539819 CCCAAGACACAGAAAAAGGCAGG + Intergenic
1177216421 21:18135598-18135620 GACATCTCAGAGATAATGGCAGG - Intronic
1178407867 21:32339288-32339310 TAAAATACTGAGAAAATGGCCGG - Intronic
1178626973 21:34226587-34226609 GACCACACAGAGAAAAAGTCTGG + Intergenic
1178851935 21:36219856-36219878 GAGAGAACAGAGAAAATGGAGGG + Intronic
1178875399 21:36410257-36410279 AAGAAAACAAAGAAAATGGCTGG - Intronic
1178939129 21:36890320-36890342 GACATGTCAGAGAAAATGACTGG + Intronic
1179388513 21:40965937-40965959 AATAAGTAAGAGAAAATGGCAGG - Intergenic
1180264860 22:10516845-10516867 CCCAAGACACAGAAAAAGGCAGG + Intergenic
1180457510 22:15523508-15523530 GACAAGAAAGAGAAAGGTGCAGG + Intergenic
1182436561 22:30334547-30334569 GACAGGAGAGGCAAAATGGCAGG + Exonic
1183086461 22:35490197-35490219 GACAGGACAGAGCAGACGGCGGG - Intergenic
1183193301 22:36335721-36335743 GACCAGCCAGAGAAAATGAGGGG + Intronic
1183278785 22:36920690-36920712 GACATCACAGAGACAAAGGCTGG - Intronic
1183796263 22:40120946-40120968 GAAAAGGGAGAGAAAAGGGCTGG + Intronic
1184524315 22:45012840-45012862 AACAGGACAGAAAAGATGGCAGG + Intergenic
1184625774 22:45727707-45727729 GAAAAGACAGACCACATGGCAGG - Intronic
1184789329 22:46689652-46689674 GAGAAGAGAGAGAGAATGCCAGG + Intronic
949142447 3:651182-651204 GAAAAGACAAAGGAAATGGCAGG - Intergenic
949401002 3:3665449-3665471 GGAGAGACTGAGAAAATGGCTGG + Intergenic
949875530 3:8623911-8623933 GACAAGGCAGTGACCATGGCTGG + Intronic
950953319 3:17024296-17024318 GCCAAGAGAGAGAAAAAGGAGGG + Intronic
951669926 3:25169385-25169407 GACATGCCAGACAAAATTGCTGG + Intergenic
952015382 3:28950646-28950668 GAAAAGCCAGAGAAGATGGAGGG - Intergenic
952559116 3:34568880-34568902 AACAAGACAGAGCAAAAAGCCGG - Intergenic
952878840 3:37970543-37970565 GAGAAGACAGAGGAAGTGGGAGG - Intronic
956756044 3:72387936-72387958 CACAAGAGAGAGGAAATGGAAGG - Intronic
959477662 3:106831148-106831170 GAAATGACAGAGAAAATGCAGGG + Intergenic
959977701 3:112480594-112480616 CACAAGACAGAGAAAAATGGGGG + Intronic
960541782 3:118869981-118870003 CACAAGTCAGAGATAATAGCTGG - Intergenic
960725778 3:120668349-120668371 GACAAGAGAGAGAACTGGGCAGG + Intronic
961587630 3:127946912-127946934 GAAAAGAAGAAGAAAATGGCTGG - Intronic
962432616 3:135333858-135333880 GAGAGAACAGAGAAAATGGAAGG - Intergenic
962626924 3:137235049-137235071 AACAACACAGAGCAAATGTCAGG - Intergenic
964464332 3:156973542-156973564 GCCAAGAGAGAGAAAATAACTGG + Intronic
964501850 3:157356577-157356599 GATAAGACAGAGGAAAAGGTGGG - Intronic
964517953 3:157533209-157533231 ATAAAGACTGAGAAAATGGCTGG + Intronic
965078702 3:164010261-164010283 GAGAACACACAGAAAAAGGCAGG + Intergenic
965251017 3:166343944-166343966 GAGGAGACAGAGAAAAAGACAGG + Intergenic
965504512 3:169497652-169497674 TACAAGAGAGAAAAACTGGCCGG - Intronic
965638706 3:170810926-170810948 GAGAAGCCAGAGAAAAGGGAAGG + Intronic
965663188 3:171064029-171064051 GACATGTGAGAGAAAATGGATGG - Intronic
966292995 3:178382439-178382461 GACAAGACACAGACTATGCCTGG + Intergenic
966518914 3:180851463-180851485 TACAAAACAGATAAAGTGGCCGG + Intronic
967177025 3:186870282-186870304 GACAAGATGGAGGAAAAGGCAGG - Intergenic
967393499 3:188980678-188980700 GAAAAGAAAAAGAAAATGCCAGG - Intronic
967848719 3:194065433-194065455 GACAGCACAGACAGAATGGCTGG - Intergenic
968137925 3:196232446-196232468 GCCAAGACTGAGAAGATGGAGGG - Exonic
969088637 4:4675471-4675493 GAAAAGACAGAAAAGATGGGTGG - Intergenic
969252453 4:5977049-5977071 GACATGACAGAAAAAAGGGAAGG + Intronic
969545015 4:7820276-7820298 GACTGGACAGAGAAATGGGCTGG + Intronic
970525923 4:16932047-16932069 TACAAGCCAAAGAAAAGGGCTGG - Intergenic
971034460 4:22677945-22677967 GAAAAGACAGATTAAATGGATGG - Intergenic
971048710 4:22835472-22835494 AACAAGACAGAGAGAGTGGAGGG + Intergenic
971108408 4:23553665-23553687 AATAAAACAGAGAAAAGGGCAGG + Intergenic
971295011 4:25380347-25380369 GACAAAGCAGATATAATGGCAGG - Intronic
971410813 4:26369866-26369888 GAGAAGAGAGAGAAAGGGGCTGG - Intronic
971417321 4:26444066-26444088 GAAAAGACAGAGACAATGAAAGG - Intergenic
971653241 4:29306947-29306969 GAGGAGACAGGGAAAATGGATGG - Intergenic
971849673 4:31968086-31968108 GAGAAGAGAGAGAAGAGGGCTGG - Intergenic
972607441 4:40626816-40626838 GACCACACACAAAAAATGGCAGG + Intronic
974583116 4:63832719-63832741 GACTATACACAGAAAATGGTAGG - Intergenic
977174179 4:93798944-93798966 AACAATACAGAGAAAAAAGCAGG + Intergenic
977266915 4:94866400-94866422 GAGAAGACAGATAATATGACTGG - Intronic
978439268 4:108716552-108716574 GACCAGACAACGAAAATGGAAGG - Intergenic
979063373 4:116096986-116097008 GCCAAGACAGAGTCCATGGCAGG - Intergenic
979727349 4:123978734-123978756 AAAAAGAAAGAAAAAATGGCAGG + Intergenic
979834273 4:125343419-125343441 GCCAAAACAGATTAAATGGCTGG - Intronic
980483174 4:133416359-133416381 GCCAGGACAGAGAAAATACCAGG + Intergenic
981018248 4:139998086-139998108 GAGAAGACAGAGAAAGGAGCAGG - Intronic
981241533 4:142482113-142482135 GGAAAGAAAGAGAACATGGCTGG + Intronic
981699685 4:147595225-147595247 GAAAAGAAAAAGAAAAGGGCCGG + Intergenic
981803723 4:148688352-148688374 GAAAAGGCGGAGAAAATAGCAGG - Intergenic
982662004 4:158218495-158218517 GAAAAGAAAAAGAAAATAGCAGG - Intronic
983209974 4:164948322-164948344 GAGAAGCAAGAGGAAATGGCAGG + Intergenic
984349258 4:178569883-178569905 GCCAAGTCTGAGAAAATGGAGGG - Intergenic
984971082 4:185191533-185191555 AACAAAACAAAGAAAAAGGCCGG + Intronic
985886118 5:2680657-2680679 GACAAGAGTGAGAACTTGGCCGG - Intergenic
986095117 5:4547102-4547124 GAAAAGAAAGAGAAAGAGGCTGG + Intergenic
986189141 5:5477674-5477696 GACAAAACAGAAAAAATTTCAGG + Intronic
987554680 5:19431562-19431584 GAGCAGATAAAGAAAATGGCCGG - Intergenic
987864561 5:23522896-23522918 GACAGAACAGGGGAAATGGCAGG - Intronic
988252628 5:28780094-28780116 GAAAAGACAGAGAAGAAGGAAGG - Intergenic
988717321 5:33841054-33841076 GACAAGACAGAGCTAAGGGTGGG - Intronic
989344510 5:40414736-40414758 GACAAGTAAGAGAAAATGAAGGG - Intergenic
993708149 5:91194963-91194985 AATAAGACAGAGAAACTGACAGG - Intergenic
994149737 5:96433557-96433579 GTAAATACAGAGAAAATGGATGG - Intronic
994281621 5:97910350-97910372 GACAAGAAAAATAAAATGGGAGG - Intergenic
997127741 5:131245115-131245137 GAAAAGACAAAGATAATGTCTGG + Intergenic
997803574 5:136890932-136890954 CAAAAGGCAGAGGAAATGGCAGG + Intergenic
997938744 5:138137609-138137631 AAAAATAAAGAGAAAATGGCGGG - Intronic
998380493 5:141721583-141721605 CACAATACATAGAAAATGGGTGG - Intergenic
998701249 5:144702574-144702596 GACCAGACAAAAAAAATGGGGGG + Intergenic
998889746 5:146733549-146733571 GACTAGAGAGAGAAGATGACAGG + Intronic
999003655 5:147952126-147952148 TACAAGAGAAAGAATATGGCCGG + Intergenic
999290831 5:150424864-150424886 GAGAAGAGAGAGAGAGTGGCCGG + Intergenic
999634083 5:153601974-153601996 GACATGACACAGACAATGGAGGG - Intronic
1000938616 5:167333215-167333237 GGCAAATCAGAGAAAATGGGAGG + Intronic
1001174235 5:169450515-169450537 CAGAAGAAAGAGAAAATGCCAGG + Intergenic
1001363108 5:171107470-171107492 GCCAAGAAAAAAAAAATGGCAGG - Intronic
1002853633 6:1019047-1019069 GATAAGACAGGCAAGATGGCAGG + Intergenic
1003034726 6:2632833-2632855 GAAAAGACAGAAAAGCTGGCAGG - Intronic
1003477826 6:6500786-6500808 AAAAAGACAGAGAAAATGGATGG + Intergenic
1004157336 6:13181935-13181957 AAAAATACATAGAAAATGGCCGG + Intronic
1004307014 6:14510141-14510163 GAAAAGGCAGAGAAAATCTCAGG + Intergenic
1005138433 6:22598643-22598665 CACCAGACAGAGGAAGTGGCAGG + Intergenic
1005235682 6:23759677-23759699 GACATTAAAGATAAAATGGCAGG - Intergenic
1005593299 6:27350653-27350675 GACACAACAAACAAAATGGCAGG + Intergenic
1007063167 6:38962750-38962772 GACAAGATAGATAATATGACTGG + Intronic
1007924874 6:45642854-45642876 GACAGGAGAGAGAAAAGGGGAGG - Intronic
1008043680 6:46829877-46829899 GCCAAGACTGAGAAAATGGATGG + Intronic
1008264220 6:49404075-49404097 GACTAGATAGAGAAAATGTCGGG - Intergenic
1008355545 6:50548274-50548296 GACAGGGGAAAGAAAATGGCAGG - Intergenic
1008594292 6:53025636-53025658 AACAAGCAAGGGAAAATGGCTGG + Intronic
1008692109 6:53991017-53991039 GACAGGAGAGAGAAAAGAGCAGG - Intronic
1008810371 6:55490053-55490075 TACAGGACGGAGAATATGGCTGG - Intronic
1009063207 6:58422243-58422265 GACAAGAAAGAGAATATCCCTGG - Intergenic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1011218649 6:85031854-85031876 GAGAAGAGAGAGAAGAGGGCAGG + Intergenic
1012437317 6:99227907-99227929 GAGGAGACAGATAAAATTGCGGG - Intergenic
1013480062 6:110545308-110545330 GAGAAGACAGAGAGAATAGGAGG - Intergenic
1014203386 6:118628496-118628518 GAAAATAAAGAGAAAAAGGCTGG + Intronic
1014225876 6:118846421-118846443 GAGAACACAGATAAAATGCCAGG + Intronic
1015016477 6:128419314-128419336 GAAAAGACAGAGAATGCGGCCGG + Intronic
1015067813 6:129052441-129052463 AAAAAGACAGAGAAAAGGCCGGG - Intronic
1015463291 6:133518055-133518077 GACAAGAGAGACCAAATGTCAGG + Intronic
1015715945 6:136191925-136191947 GACAACACTCAGAAAGTGGCTGG - Exonic
1015762784 6:136683025-136683047 GTAAAGACATACAAAATGGCGGG + Intronic
1016284762 6:142461174-142461196 TCCAAGACAGAGAAAATGGCAGG - Intergenic
1016316189 6:142790363-142790385 GATAAGATAGAGGAAATGGAAGG - Intronic
1016739213 6:147509777-147509799 GAAAAGAAAGAGAAAAAGGAAGG - Intronic
1016916497 6:149248823-149248845 GACAAGACAGAGAAAATGGCAGG - Intronic
1017963540 6:159244168-159244190 GACAAGGGAAAGAAAATGGTAGG + Intronic
1018039952 6:159913064-159913086 GTAAAGACAGAAAAATTGGCTGG + Exonic
1018441101 6:163814116-163814138 GAGAAGAAAGAGAAAGTGGTGGG - Intergenic
1018537304 6:164835165-164835187 AACAAGAGAGAGAGAAAGGCAGG + Intergenic
1020460381 7:8423622-8423644 GGGAAGAGAGAGAGAATGGCAGG - Intergenic
1021056369 7:16051969-16051991 GACTAGACAGAGAAATTAGAAGG - Intergenic
1021248249 7:18291475-18291497 GCCAAGACTCAGAAAATTGCTGG + Intronic
1021503239 7:21352714-21352736 GACAAGACAGAGAAAAAGAGAGG + Intergenic
1021912693 7:25401934-25401956 GAGAAGACAGAGAAAATTTCAGG + Intergenic
1021945462 7:25721758-25721780 GCCAGGACAGAGAAAATGATGGG + Intergenic
1022231881 7:28422219-28422241 GGAAAAACAGAGAAAATTGCAGG + Intronic
1022281155 7:28911109-28911131 TACTACACAGAGAAAATGGCAGG - Intergenic
1022797699 7:33745309-33745331 GTGAAGACAGAGAGAAAGGCAGG + Intergenic
1022845619 7:34206892-34206914 GAGAAAAAAGAGAAAATGGCAGG + Intergenic
1023907896 7:44535076-44535098 TACAAAACAAAAAAAATGGCCGG + Intronic
1023924865 7:44660544-44660566 GCCAAGACAGACAATATGGTGGG - Intronic
1024061577 7:45702738-45702760 GACACGGCAGAGCAGATGGCAGG - Intronic
1024224679 7:47316863-47316885 GAAAGCAAAGAGAAAATGGCAGG + Intronic
1025158053 7:56627936-56627958 AAAAATACAGAAAAAATGGCAGG - Intergenic
1026653156 7:72233417-72233439 TTCAAGAGAGAGAAAAAGGCTGG + Intronic
1026771766 7:73206378-73206400 GAAATGACAGGGAAAATGACAGG + Intergenic
1026809344 7:73449313-73449335 AAGAAGACAGAGAATGTGGCTGG + Intronic
1026891959 7:73987579-73987601 GATGAGACTGAGAGAATGGCTGG + Intergenic
1027012634 7:74759774-74759796 GAAATGACAGGGAAAATGACAGG + Intronic
1027075406 7:75186279-75186301 GAAATGACAGGGAAAATGACAGG - Intergenic
1027250990 7:76398599-76398621 GTAAAGTTAGAGAAAATGGCTGG - Intronic
1027776551 7:82472579-82472601 GACAAGACAGATAAGATCCCTGG + Intergenic
1028094767 7:86746248-86746270 GAAAAGTCAGAAAGAATGGCAGG + Intronic
1028256210 7:88600968-88600990 TAGAAGACTGAGAAAATGGGTGG + Intergenic
1028340236 7:89709779-89709801 GACAAGAAAAGGAAAATGACTGG + Intergenic
1028548652 7:92031908-92031930 GAAAAGAAAGAGAAAGTGGTTGG + Intronic
1029732187 7:102445825-102445847 GAAAAGAAAGAGAAAAGGGAGGG - Intronic
1030643287 7:112030235-112030257 CTCAAGACTGAGAAAAGGGCTGG + Intronic
1032133476 7:129251677-129251699 GCAAAGACAGAGAATAAGGCTGG - Intronic
1032205839 7:129864530-129864552 GAAAAGAAAAAGAAAATGCCTGG - Intronic
1032311641 7:130792928-130792950 GACAGTGCAGAGAAAATGGAAGG - Intergenic
1032617149 7:133485503-133485525 GACAACAATGAGAAAAGGGCAGG - Intronic
1033163649 7:139019219-139019241 GAGAAGACAGAGAGAATGGCAGG + Intergenic
1033272225 7:139942728-139942750 GAAAAGTCAGATAAAATGGGAGG + Intronic
1033970042 7:147027827-147027849 GACATGACAGAGATTCTGGCTGG + Intronic
1034106603 7:148495890-148495912 GACAAAACAGAGAGAATGGGAGG - Intergenic
1034695869 7:153053012-153053034 GACAAGTTAGAAGAAATGGCTGG + Intergenic
1034724570 7:153323308-153323330 GACCAGCCAGATAAAAAGGCTGG + Intergenic
1035724385 8:1815460-1815482 GATCAGAGAGAGAAAGTGGCAGG + Intergenic
1036826710 8:11982447-11982469 TACAAGAGTGAGAAAAAGGCAGG + Intronic
1037005827 8:13778510-13778532 GAGAACAAAGAGATAATGGCAGG - Intergenic
1037478213 8:19278277-19278299 AACAAAGCAGACAAAATGGCTGG - Intergenic
1037536267 8:19827494-19827516 GACGAGGCAGAGAAAATGCTAGG - Intronic
1038023996 8:23573070-23573092 GACAAGACAGGGACAAAGACTGG - Exonic
1038697447 8:29818864-29818886 GAGGAGACAGAGAAACTGGCAGG - Intergenic
1039526805 8:38224252-38224274 AAGAAGACAGAGAAAAGGGCCGG - Intergenic
1041659300 8:60385694-60385716 GACAGTACAGAAAAAATGGGTGG - Intergenic
1041864148 8:62549693-62549715 GAGAAGAGAGAAAAACTGGCAGG - Intronic
1042090157 8:65150795-65150817 GAAAGGAAAGAGAAAAAGGCTGG + Intergenic
1042337548 8:67644412-67644434 GCCAAGACAGCCATAATGGCCGG - Intronic
1043012604 8:74900071-74900093 CACAGGACAGAGAAGATGGGTGG + Intergenic
1043153043 8:76742431-76742453 GACCAGTCAGTGAACATGGCAGG - Intronic
1043175595 8:77020114-77020136 GCCAACACAGTGAAATTGGCTGG + Intergenic
1043545763 8:81313798-81313820 GAAAAGACAGAAGAAATGGCGGG + Intergenic
1044489293 8:92793142-92793164 GGGAAGACAGAGAAAGAGGCTGG - Intergenic
1044532726 8:93326122-93326144 GAGAAGACCGAGAAGGTGGCAGG - Intergenic
1045000411 8:97873368-97873390 GGCAACACAGAGAAACTGTCTGG - Intronic
1045324173 8:101104690-101104712 GAAAAGAGAGGGAAAATGGAGGG - Intergenic
1045749669 8:105468247-105468269 GAGCAAAGAGAGAAAATGGCAGG - Intronic
1046166810 8:110447925-110447947 AAGAAGACAGATAAAATTGCAGG - Intergenic
1047296023 8:123571144-123571166 GGCAAGACAGAGACGAGGGCAGG - Intergenic
1047361915 8:124177136-124177158 GATAAGACAGAGAAGAATGCCGG + Intergenic
1047923694 8:129661234-129661256 GACAGGAGAGAGAACATGGTAGG + Intergenic
1048141339 8:131797596-131797618 GAGAAGACAGGGAATAAGGCTGG + Intergenic
1048320957 8:133399898-133399920 GACATGCCAAAGAAGATGGCAGG - Intergenic
1048615678 8:136073126-136073148 GACAAGGGAGAGAAAATGTGAGG + Intergenic
1049064983 8:140306173-140306195 GACAAGAAAAAGAAAAGTGCTGG + Intronic
1049186132 8:141254881-141254903 GAACAGACAGAGAAAAACGCTGG + Intronic
1049256539 8:141617059-141617081 GATAAGGCGGATAAAATGGCTGG - Intergenic
1049700941 8:144012257-144012279 GGCGAGACAGAGAAAAGGTCAGG + Intronic
1050314856 9:4390994-4391016 GAGTAGACAGAGAAATAGGCAGG - Intergenic
1050666440 9:7942985-7943007 GACACGACAGAGAAAATCTTTGG - Intergenic
1051110398 9:13628430-13628452 GAGCAGACAGACAAAATAGCTGG + Intergenic
1051776246 9:20637360-20637382 CAGAGGACAGAGAAAATGGCTGG + Intergenic
1052401894 9:28011225-28011247 GACACGACACAAAAAATTGCTGG + Intronic
1055875363 9:80935495-80935517 GCCAGGAAAGAGATAATGGCTGG - Intergenic
1055892438 9:81137724-81137746 GTGAAGACAGAGAAAATGATAGG + Intergenic
1056335590 9:85565551-85565573 GACAATAAAGAGAAAAGGACAGG + Intronic
1059130288 9:111740866-111740888 AACAAAACAAAAAAAATGGCCGG - Intronic
1059297169 9:113281713-113281735 GTCAAGAATGAGAAAATGTCAGG - Intronic
1059519529 9:114927419-114927441 GAGAAGACAGAGAAAGTGTAGGG - Intronic
1059650999 9:116315786-116315808 GAAGAGACAGAGAAAAAGGAAGG + Intronic
1060570460 9:124634430-124634452 AACAAGAGACAGAAAATGGAAGG - Intronic
1060960445 9:127677008-127677030 GACAAGACAGATAAAATGGCGGG - Intronic
1061081482 9:128373408-128373430 GACAAAAGAGAGAAAATGAAGGG - Intronic
1061255874 9:129454025-129454047 GACTGGACAGAGGAAAGGGCAGG + Intergenic
1203370686 Un_KI270442v1:301748-301770 GAAAAGAAATAAAAAATGGCAGG - Intergenic
1203612041 Un_KI270749v1:17814-17836 CCCAAGACACAGAAAAAGGCAGG + Intergenic
1186346404 X:8697498-8697520 TCCCAGACAGAGAGAATGGCAGG + Intronic
1187411754 X:19056714-19056736 GACAAGCCAAAGAAAATAGGAGG - Intronic
1187932420 X:24305532-24305554 TAGAAGTCAGATAAAATGGCTGG - Intergenic
1188214020 X:27456207-27456229 GAAAAGAAAGAGAAAAGGACAGG - Intergenic
1188298348 X:28478049-28478071 TACAAAACAGAAAAAATAGCTGG - Intergenic
1188468418 X:30509171-30509193 TCAGAGACAGAGAAAATGGCAGG + Intergenic
1189019755 X:37321882-37321904 GAGGAGACAGAGAAAAAGACAGG + Intergenic
1189791873 X:44612494-44612516 GAAAAGAAAAAGAAAAAGGCTGG - Intergenic
1190303292 X:49068459-49068481 GACAAGACACAGAAAAAGAAAGG - Intronic
1191950619 X:66587724-66587746 GACAAAACAAAGAAAATTTCAGG - Intergenic
1193824910 X:86212591-86212613 CACAATACAGACAAAAAGGCAGG - Intronic
1194139408 X:90191434-90191456 GAAGAGAGAGAGAAATTGGCTGG + Intergenic
1194353795 X:92855835-92855857 CCCAAGAAAAAGAAAATGGCTGG + Intergenic
1194550741 X:95295590-95295612 TACAAGCCAGAGAAAATTGGGGG + Intergenic
1195000955 X:100642930-100642952 AACAAGACAGACAAAATCCCAGG - Intergenic
1195525481 X:105884312-105884334 GCAATGTCAGAGAAAATGGCTGG - Intronic
1196099723 X:111835164-111835186 GAAAAGAGAGAGAAAATGTAAGG + Intronic
1196321730 X:114349074-114349096 GAAAAAAAAGAGAAAATGGCTGG + Intergenic
1196463430 X:115951094-115951116 GTCAAGACAGAGAAAACAGAAGG + Intergenic
1196918821 X:120565385-120565407 AACAAAACAGAAAAAACGGCTGG + Intronic
1198322390 X:135531490-135531512 GATAAGCCAGAGAAGATGGAAGG - Intronic
1198688538 X:139253824-139253846 GAGATGACAGAGAAAGAGGCAGG + Intergenic
1199259239 X:145751573-145751595 TTCAATACAGAGAAAATGACAGG + Intergenic
1199414605 X:147566716-147566738 GACAAGACAGAGAACAGAGCAGG + Intergenic
1199508101 X:148589061-148589083 GACAAGACAATCAAATTGGCAGG + Intronic
1199638783 X:149839858-149839880 GAAAAGATAAAGAAAATGGATGG - Intergenic
1199751806 X:150826735-150826757 GAAAAGACAGAGAAGTTGTCAGG - Intronic
1199940752 X:152625433-152625455 GAGAAGAAAGAAAAAATGGATGG + Intergenic
1200485152 Y:3760370-3760392 GAAGAGAGAGAGAAATTGGCTGG + Intergenic
1200662155 Y:5972907-5972929 CCCAAGAAAAAGAAAATGGCTGG + Intergenic
1201266428 Y:12211495-12211517 GAAAAGAGAGAGAAAAAGGAAGG + Intergenic
1201544302 Y:15143778-15143800 GACACTACAGAGAAATTAGCAGG - Intergenic