ID: 1016916498

View in Genome Browser
Species Human (GRCh38)
Location 6:149248827-149248849
Sequence CTGTGACAAGACAGAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 574}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016916498_1016916500 1 Left 1016916498 6:149248827-149248849 CCATTTTCTCTGTCTTGTCACAG 0: 1
1: 0
2: 6
3: 66
4: 574
Right 1016916500 6:149248851-149248873 AGCAGTCATGTCCCCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016916498 Original CRISPR CTGTGACAAGACAGAGAAAA TGG (reversed) Intronic
900719017 1:4163121-4163143 TTGTGTCAAGAAAGAAAAAAGGG - Intergenic
900994870 1:6115483-6115505 CTGTGACCAGCCAGAGAAAAGGG - Intronic
901167990 1:7233481-7233503 CAGTGACAAGCCAAAGAAAAGGG - Intronic
901611796 1:10504587-10504609 CTGGGCCAACACAGAGAGAAAGG - Intronic
901666605 1:10829865-10829887 TTCAGACAATACAGAGAAAAAGG - Intergenic
902780117 1:18699497-18699519 CTGGGACAGGTCAGAGAAAGAGG - Intronic
902890122 1:19437126-19437148 CTGTTTCATGACAGATAAAAAGG + Intronic
902931305 1:19733503-19733525 CAGTGACAAGAAGGAGAAACAGG + Intronic
905129952 1:35746808-35746830 GAGTGACAAGAAAGAGAACATGG - Exonic
905544152 1:38784412-38784434 CTGTGACAAGACTGGGAAGAGGG + Intergenic
906096112 1:43225132-43225154 CTTTGACAAGAAAGAGACAAAGG + Intronic
906166604 1:43691064-43691086 CTGGGACAGGACACAGAGAAAGG - Intronic
906946385 1:50297936-50297958 CTGGAATAAGACAGAGGAAATGG - Intergenic
907101689 1:51843500-51843522 AAGTGTCAAGACAAAGAAAAAGG - Intronic
907235621 1:53043994-53044016 CTGAAACAAGATAGAAAAAAAGG - Intronic
907820091 1:57958780-57958802 ATGTGAGAAGACATAGAAAGAGG - Intronic
907994624 1:59617218-59617240 AAGTGAGAAAACAGAGAAAAAGG + Intronic
908496377 1:64699084-64699106 CTGTGGCAGGACAGAAAAAAGGG - Intergenic
908658955 1:66417846-66417868 CTGTCACAGGACCTAGAAAAGGG + Intergenic
908722470 1:67140156-67140178 CTGTTACAAGCAACAGAAAATGG + Intronic
908807943 1:67950011-67950033 AAGTGACAAGACAAAGGAAAAGG + Intergenic
908944516 1:69477909-69477931 GTGTTACAAGAGAGAAAAAAAGG - Intergenic
909141507 1:71872404-71872426 CTGTGACAAGCCAGTTACAAGGG + Intronic
909593929 1:77383331-77383353 CTGTGAGAAGTCATAAAAAATGG + Intronic
909878260 1:80839039-80839061 CTGCCACCACACAGAGAAAAGGG + Intergenic
910226676 1:84943014-84943036 CTGTTACAAGTAACAGAAAACGG + Intronic
910313624 1:85857070-85857092 CTCTGACAAAACTCAGAAAAAGG - Intronic
910689484 1:89951162-89951184 CTGTGACAAGAGAAAGAATGAGG - Intergenic
911277120 1:95875808-95875830 CTATGACACAACAGAGAAACTGG + Intergenic
911322458 1:96431580-96431602 CTTTGAAAAGGCAGATAAAATGG - Intergenic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
911977629 1:104520621-104520643 CTATAACAAAACAGAAAAAAAGG + Intergenic
912061565 1:105678245-105678267 CTCTGACAATAAAGAGCAAATGG + Intergenic
913082135 1:115398505-115398527 CTGTGAGCAAAGAGAGAAAAGGG - Intergenic
913261455 1:117001875-117001897 CTGTGACAAGAGAAACATAAAGG - Intronic
914443468 1:147728050-147728072 CTGAGACAAAAAAAAGAAAAAGG - Intergenic
915999687 1:160603127-160603149 CATTGACAAGAGAAAGAAAATGG - Intergenic
917044060 1:170837032-170837054 GTGTGTGAAGAGAGAGAAAAAGG + Intergenic
917144229 1:171870900-171870922 ATTTGAGAAGACAGAGAAAAAGG + Intronic
917402079 1:174660855-174660877 CGGTGACAAAGCAGAGAAAAGGG - Intronic
917419987 1:174853116-174853138 CTGTGCCAAAACACATAAAATGG + Intronic
917888093 1:179407664-179407686 CTGTCAGAAGTCAGAGACAAAGG - Intronic
918327663 1:183425856-183425878 CTGTGACTAGAAAGAGGAATTGG + Intergenic
918805821 1:189042441-189042463 TTGTGAGAATGCAGAGAAAAGGG - Intergenic
918920238 1:190699190-190699212 GTGGGACAAGATAGAGATAATGG + Intergenic
919397940 1:197073554-197073576 ATTTCACAAGACAGAGAAAGAGG + Intergenic
919414423 1:197289604-197289626 CTGAGACAGAACAGAGAGAATGG - Intronic
919735508 1:200947859-200947881 GTGTGAGATGACAGAGAACAGGG + Intergenic
920261041 1:204688114-204688136 CTGAAGCAAGACAGAGTAAATGG - Intergenic
920760598 1:208780463-208780485 AAGTGACAAGACAAAGGAAAAGG + Intergenic
921409140 1:214815725-214815747 CTCTGAGAAGTCAGATAAAATGG - Intergenic
921571942 1:216790188-216790210 CTGTTACATGACAGAGAAATAGG + Intronic
921635923 1:217493120-217493142 CTTTTCCAGGACAGAGAAAATGG - Intronic
921728404 1:218549774-218549796 AAGTGACAAGACAAAGGAAAAGG + Intergenic
922367979 1:224883912-224883934 ATGTGACAAGACAAAGGAAAAGG + Intergenic
922789363 1:228302471-228302493 CAGTGAAGACACAGAGAAAATGG - Intronic
922902179 1:229145830-229145852 CTGAGACAAGCCAGGGAAGAAGG + Intergenic
923169228 1:231397875-231397897 CTGAGATAAGACAGATGAAATGG + Intronic
923184492 1:231557757-231557779 CAGTGACTAGCCACAGAAAATGG + Intronic
924733444 1:246732984-246733006 CTGAGACAAAACTGAGCAAATGG - Intronic
924795256 1:247288183-247288205 CAGTTAAACGACAGAGAAAAAGG - Intergenic
924852526 1:247844674-247844696 CGGTGACAAAACAAAAAAAACGG - Intergenic
1063251674 10:4281217-4281239 AAGTGACAAGACAAAGGAAAAGG + Intergenic
1063960848 10:11304394-11304416 CTGTTATAAGCCACAGAAAATGG - Intronic
1064682105 10:17820571-17820593 GTTTGACAATACAGTGAAAATGG + Intronic
1065087303 10:22191679-22191701 ATGTGACAAGACAAACAAAAAGG + Intergenic
1065149931 10:22812391-22812413 CTATGGCAAGAAGGAGAAAAGGG + Intergenic
1065284991 10:24179186-24179208 AAGTGACAAGACAAAGTAAAAGG + Intronic
1065697971 10:28397716-28397738 TTGTGAGGATACAGAGAAAATGG - Intergenic
1065886799 10:30085484-30085506 CTTTGAGAAGACAGAGATTAAGG + Intronic
1066200557 10:33139718-33139740 CTGTTACAAGCAACAGAAAATGG - Intergenic
1066504025 10:36023379-36023401 CTGTTACTGGACAGAGACAAAGG + Intergenic
1067281857 10:44879320-44879342 AAGTGACAAGACAGAGGAGAAGG - Intergenic
1067298606 10:44990443-44990465 AAGTGACAAGACAGAGGAGAAGG + Intronic
1068069264 10:52175628-52175650 TTGTGAGGATACAGAGAAAACGG - Intronic
1068130925 10:52894267-52894289 CAGTGACAAGACAGGAAACAGGG + Intergenic
1068341460 10:55709583-55709605 CTGTCAGAATACAGAGGAAATGG + Intergenic
1068874531 10:61982163-61982185 CTGTGACAACTCAGAGCACACGG - Intronic
1069062662 10:63910553-63910575 AAGTGACAAGACAAAGAAAAAGG + Intergenic
1070575440 10:77673730-77673752 CTGTGAAATGACAATGAAAAAGG + Intergenic
1071705656 10:87995504-87995526 CCCTGAAAAGACACAGAAAATGG - Intergenic
1071861256 10:89675019-89675041 AAGTGACAAGACAAAGGAAAGGG - Intergenic
1072278771 10:93847359-93847381 ATGTGACAAAACAAACAAAAAGG + Intergenic
1073842991 10:107519589-107519611 CAGTGAGTAGTCAGAGAAAAAGG - Intergenic
1073898770 10:108194414-108194436 CTGAGAAAATGCAGAGAAAAGGG + Intergenic
1073990572 10:109257985-109258007 GTGTGAGAAGACAGAGTTAAAGG + Intergenic
1074125271 10:110524200-110524222 CTATGAGATGACAGAGAAAAAGG + Intergenic
1074283898 10:112079906-112079928 CTGTGAGAGGTCAGAGAAGAAGG - Intergenic
1074369328 10:112886895-112886917 CTTTGGGAAGACAGAGAAAGGGG - Intergenic
1075554721 10:123422031-123422053 AGGTGACAAGACAGAGAAGGGGG - Intergenic
1076297733 10:129400221-129400243 CAGTGAAAAGACAAATAAAATGG - Intergenic
1076507869 10:130989919-130989941 CTGCCACCAGACAGAGAAACTGG + Intergenic
1077736069 11:4792555-4792577 CTGACCCAAGACAGTGAAAATGG - Intronic
1078003932 11:7518326-7518348 CAGTTACATGAGAGAGAAAAAGG + Intronic
1078098518 11:8314956-8314978 CTTTGGCAAGGCAGAGAAAAGGG - Intergenic
1078852203 11:15174622-15174644 CTGTTACAAGCCAAAGACAAAGG + Intronic
1079564129 11:21860135-21860157 CTGTGCTAAGAGAGAGAATATGG - Intergenic
1079768591 11:24428388-24428410 AAGTGACAAGACAAAGGAAATGG - Intergenic
1080270924 11:30449920-30449942 ATATGACTAGACAGAGGAAAGGG - Intronic
1081058232 11:38438294-38438316 CTTTTACAAGACACAGATAAGGG + Intergenic
1082710270 11:56546729-56546751 CTGTGTCAGGACAGAATAAAAGG + Intergenic
1084931541 11:72560335-72560357 CTGTGACAGGGCAGAGAACCTGG + Intergenic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1086330138 11:85745745-85745767 CAGAGTAAAGACAGAGAAAATGG - Exonic
1086526868 11:87738124-87738146 GTGAGACAAGAAAGAAAAAAAGG - Intergenic
1086590040 11:88503825-88503847 GTCTGACAAAACAGATAAAATGG + Intergenic
1087362606 11:97179824-97179846 ATGTGACTTGACAGAGAAGACGG - Intergenic
1087529725 11:99364127-99364149 CTGATACAATAAAGAGAAAAAGG + Intronic
1087732327 11:101792961-101792983 CTGACACAAGACAGAATAAAAGG - Intronic
1088392647 11:109331973-109331995 ATATGACAAGACAGTAAAAAGGG - Intergenic
1088747832 11:112819293-112819315 ATGTGAAAAGACAAAGAAAAAGG + Intergenic
1090395464 11:126415433-126415455 CTGGGACAGGACAGATAAAGAGG + Intronic
1090402490 11:126458079-126458101 CTGGGCCATGACAGGGAAAAAGG - Intronic
1090442188 11:126733691-126733713 CTGTGTCAAGACACAGAAAGGGG - Intronic
1091264460 11:134259724-134259746 CTTTGGCAAGAAGGAGAAAAAGG + Exonic
1091636334 12:2199716-2199738 CTGGGACCTGACAGAGGAAAAGG - Intronic
1091877223 12:3945402-3945424 CTGTGACAAGTCAGAAAGACTGG + Intergenic
1092126632 12:6079296-6079318 CTGAGACAGGACACAGAAACAGG + Intronic
1092298999 12:7227300-7227322 ATGTGATAAGAATGAGAAAATGG + Intergenic
1092318998 12:7451439-7451461 TTGAGACTAGACAGAGACAAAGG + Intronic
1092950071 12:13494083-13494105 CAGTGAGAATATAGAGAAAAGGG - Intergenic
1092955204 12:13543191-13543213 CTGAGATAAGATAGAGGAAAAGG - Exonic
1093092877 12:14941035-14941057 CTGTGAGACTGCAGAGAAAAGGG + Intergenic
1093395891 12:18681795-18681817 CTTTGAAATGAGAGAGAAAAAGG - Intergenic
1093719349 12:22420629-22420651 ATGTGACAAGAGAGAGGAAAGGG - Intronic
1093719848 12:22427269-22427291 ATGTGACAAGAGAGAGGAAAGGG - Intronic
1093722371 12:22459857-22459879 GTGAGACTAGGCAGAGAAAAGGG + Intronic
1093730538 12:22561195-22561217 CTTTGATGAGAAAGAGAAAATGG - Intergenic
1093793454 12:23283141-23283163 CAGTGAGGATACAGAGAAAAGGG - Intergenic
1093803590 12:23404328-23404350 CTGTCACAAGAGACAAAAAAAGG + Intergenic
1095337880 12:41050430-41050452 CAGTGGCAAGAAAGAGAGAAGGG + Intronic
1095906314 12:47381875-47381897 ATGTCACAAGACAAGGAAAAGGG + Intergenic
1096418468 12:51434507-51434529 CTTTGGCAAGACAAAGAAAATGG + Intronic
1096928341 12:55173951-55173973 CTCCAACAAGAGAGAGAAAAGGG - Intergenic
1096945792 12:55408627-55408649 TTGTGACAAAAAATAGAAAAAGG + Intergenic
1097233237 12:57524585-57524607 ATGTGGGAAGACACAGAAAAAGG - Intronic
1097842874 12:64339048-64339070 TTGTGACAAGACAAAGCAAAGGG - Intronic
1098056536 12:66512039-66512061 TTGTGACAAGAGAGAGAAAGAGG - Intronic
1099294608 12:80814538-80814560 CAGTGCCAAAACAGAGATAATGG - Intronic
1099382619 12:81973966-81973988 ATTTCACAAGACAGAGAAAGAGG + Intergenic
1099471664 12:83057382-83057404 CTCTGTCAAGACACTGAAAATGG - Intronic
1100083589 12:90880368-90880390 CTGTCACATGATAAAGAAAAAGG - Intergenic
1100523274 12:95396905-95396927 CTGTGACACTACAGACAAGATGG - Intergenic
1101583716 12:106066692-106066714 CTGTGACAACAGACTGAAAAAGG - Exonic
1101928473 12:108992804-108992826 CTGGGACTAGACAGAGATGAGGG + Intronic
1101973649 12:109335983-109336005 CTGTCACAAAAAAAAGAAAAAGG - Intergenic
1103318806 12:120078190-120078212 CTGTGACAAGACAGAGACAGGGG - Intronic
1104110572 12:125700603-125700625 CTTAAGCAAGACAGAGAAAATGG + Intergenic
1104229784 12:126873505-126873527 CTGTGAAAATATAGAGAAAGAGG + Intergenic
1104547959 12:129729530-129729552 CTTTGGCAAGAAAGAAAAAAAGG - Intronic
1105319877 13:19308837-19308859 ATGTGACAATACAGAGCAAGTGG + Intergenic
1105484293 13:20811723-20811745 CTGAGGCAAGACAGAAAACAAGG + Intronic
1105967099 13:25394959-25394981 CTGTGACAAGACAAAGGAAAAGG - Intronic
1106217099 13:27712591-27712613 CGGTGACAATACACAGAAGATGG - Intergenic
1106874974 13:34061619-34061641 AAGTGACAAGACAGAGGAAATGG - Intergenic
1108157827 13:47604554-47604576 CTGGGAAAAGGCAGAGACAAAGG + Intergenic
1108447100 13:50520499-50520521 CTGTGACAGGACAGTGACACCGG + Intronic
1109166538 13:59041907-59041929 ATGTGAGAAGACAAAGAAAGGGG + Intergenic
1109433670 13:62270750-62270772 TTGTGAGAATACAGAGAAATTGG - Intergenic
1110480665 13:75971709-75971731 CTGAGACAATTCAGAGAAATTGG - Intergenic
1110527529 13:76556177-76556199 CTCTTTCCAGACAGAGAAAAGGG + Intergenic
1110944257 13:81393001-81393023 AACTGACAAGACATAGAAAAAGG - Intergenic
1111251393 13:85606329-85606351 CTGTCGCAAGAAAGAGAAAATGG + Intergenic
1111620808 13:90722997-90723019 CAATGACAAAACACAGAAAAAGG + Intergenic
1112136964 13:96590320-96590342 AGGTGAGAATACAGAGAAAAGGG - Intronic
1112597158 13:100817876-100817898 AAGTGACTAGACAAAGAAAAGGG + Intergenic
1113142821 13:107174155-107174177 GGGTGGCAACACAGAGAAAATGG - Intronic
1114163580 14:20195969-20195991 AAGTGACAAGACAAAGAAAAAGG + Intergenic
1116209570 14:41917441-41917463 CCCAGAGAAGACAGAGAAAAGGG - Intergenic
1118400010 14:65370905-65370927 AAGTGACAAGACAAAGGAAAAGG + Intergenic
1118685998 14:68291861-68291883 CTGTGAACAGACAGGGAGAAGGG - Intronic
1118757995 14:68859298-68859320 CAGTGACAAGACAAAGGAAAAGG - Intergenic
1119442543 14:74637985-74638007 ATGGGACAAGAGAGAGAGAAGGG + Intergenic
1119538492 14:75422774-75422796 TTGTCACATGACAGAAAAAATGG + Intergenic
1119751032 14:77077424-77077446 CTGTAATAATACAGAGAAACAGG - Intergenic
1120961808 14:90131790-90131812 CAGTGAGGAGACAGAGAAATTGG + Intronic
1120963107 14:90142886-90142908 AAGTGACAAGACACAGGAAAAGG + Intronic
1121343261 14:93117189-93117211 CTTTAACAAGGTAGAGAAAACGG + Intergenic
1121401744 14:93685320-93685342 ATGTGAAAGGTCAGAGAAAATGG + Intronic
1121939827 14:98059478-98059500 CTGTGAGAGGAGAGAGAGAAAGG + Intergenic
1122455833 14:101850316-101850338 CTGTTGCAATACAGAAAAAATGG - Intronic
1123766171 15:23480492-23480514 ATTCCACAAGACAGAGAAAAAGG - Intergenic
1124151599 15:27184131-27184153 AAGTGACAAGACAAAGATAAAGG + Intronic
1124875524 15:33589091-33589113 CGGTGAGGATACAGAGAAAAGGG - Intronic
1124894598 15:33764605-33764627 CTGTGACAACATTGAGAAGAAGG + Intronic
1125067801 15:35511425-35511447 ATGTGAGATGAAAGAGAAAAAGG + Intronic
1125292229 15:38162776-38162798 CAGTGAAATGACAGAGAAATGGG + Intergenic
1125333400 15:38604106-38604128 AAGTGACAAGACAGAGTAAAAGG - Intergenic
1125419545 15:39490541-39490563 GTTTGACAAGACAGAGAAAAGGG - Intergenic
1125439853 15:39690355-39690377 ATGTGGTAAGACAGAGATAAAGG + Intronic
1125564794 15:40668421-40668443 CTGTTACAAGCAACAGAAAATGG + Intergenic
1127473353 15:59309980-59310002 CTGTGAGAACAGAGAGGAAAGGG - Intronic
1127707846 15:61564805-61564827 GTGTGACAAAGCAGAGAAGAGGG + Intergenic
1128563130 15:68681702-68681724 ATCTGATAAGACAGAGAAAGGGG + Intronic
1128655371 15:69457359-69457381 GTGTCACAAGACAAAGATAAGGG + Intergenic
1130552118 15:84896054-84896076 CTGTGACAAGTCATTGATAATGG + Intronic
1130770282 15:86917150-86917172 CTGGGAGAAGATAGAGAAGATGG + Intronic
1131005639 15:88975484-88975506 CTGTGAGAATTCTGAGAAAAGGG - Intergenic
1131998042 15:98151725-98151747 CTGAGACCAGAGAGAGAACAGGG + Intergenic
1132049011 15:98591572-98591594 CTATGACGAGAGAGAGAAAGTGG - Intergenic
1132141328 15:99399133-99399155 CTGTGTGAACACCGAGAAAATGG + Intergenic
1132406848 15:101546940-101546962 ATGGTACAAGACAGAAAAAAAGG + Intergenic
1133209327 16:4254315-4254337 CTGTGACATGTCATAGAAATGGG - Intergenic
1133892503 16:9894017-9894039 GTGAGACAACACAGACAAAAGGG + Intronic
1134883108 16:17764772-17764794 CTGTGGCAAAGCAGAGAAATAGG - Intergenic
1135618128 16:23929600-23929622 CTGTAACAACACAGAGACGATGG + Intronic
1135671469 16:24379145-24379167 AAGTGACAAGACAAAGGAAAAGG - Intergenic
1135762368 16:25147540-25147562 CTGTGAATGGACAGAGAAATGGG - Intronic
1137438829 16:48481844-48481866 AAGTGACAAGACAAAGGAAAAGG + Intergenic
1137702709 16:50508335-50508357 CCCTGAGAAAACAGAGAAAAGGG + Intergenic
1137922661 16:52506289-52506311 CTATCAAAAGACAGATAAAAAGG + Intronic
1138175899 16:54897932-54897954 CAGTGACAGGGCAGAAAAAAGGG + Intergenic
1140317616 16:73914239-73914261 CCCTGAAATGACAGAGAAAATGG + Intergenic
1140568544 16:76073830-76073852 CTGTGAGAAGAGAGAGTTAAAGG - Intergenic
1141197783 16:81874258-81874280 CTGGGTCAATACAGAGAAAGTGG - Intronic
1141225809 16:82113849-82113871 CAGTGACTGGACACAGAAAAGGG - Intergenic
1141466130 16:84206900-84206922 CAGGGACAAGACAGTGAACAGGG - Intergenic
1142950626 17:3476651-3476673 CTGAGACAATAAATAGAAAAGGG + Intronic
1143348893 17:6272201-6272223 CTGTAGGAACACAGAGAAAAGGG - Intergenic
1144003857 17:11081878-11081900 TTGTCACAAGAAATAGAAAATGG - Intergenic
1144160931 17:12557134-12557156 TTGGAAGAAGACAGAGAAAACGG + Intergenic
1144220338 17:13094100-13094122 AAGTGACAAGACAAAGAAAAAGG - Intergenic
1144330166 17:14215915-14215937 CTGTGACAAGACAGACAGGAAGG - Intergenic
1144702951 17:17350738-17350760 CTCTGGCAGGACAGAGAAACAGG - Intergenic
1144798307 17:17907532-17907554 CTGTGAAATCAGAGAGAAAATGG + Intronic
1145405027 17:22581917-22581939 CTGTGCTAAGAAAGAGAAATTGG - Intergenic
1145840017 17:27986877-27986899 CTGTCACAAAAGACAGAAAATGG - Intergenic
1146410802 17:32582552-32582574 CTGTGACATGACCCAGAATATGG + Intronic
1146468786 17:33108218-33108240 GTGTAGGAAGACAGAGAAAATGG - Intronic
1147407691 17:40224574-40224596 CTGTGACAGGATAGGAAAAATGG - Intronic
1147685964 17:42287136-42287158 CTGTGACCACACAGAGAAGGTGG + Intergenic
1148153355 17:45409415-45409437 CTGTCACAAGGAAGAGAAGATGG + Intronic
1148344321 17:46893462-46893484 CTGGGCAAAGACAGATAAAAAGG - Intergenic
1148730872 17:49835630-49835652 GTGTGACAACACAGAGGAGAGGG + Intergenic
1149043751 17:52220505-52220527 AAGTGACAAGACAAAGAAAAAGG + Intergenic
1149324078 17:55511974-55511996 CAGTGATAAGACAGAGAAGCAGG + Intergenic
1149635863 17:58168767-58168789 CTGAGACAAGAGGGAGAAAAGGG - Intergenic
1149797988 17:59539344-59539366 CTGTGACCTCACAGAGGAAAGGG + Intergenic
1150726030 17:67652358-67652380 CTGGGACAAGGCAGAGCAAAGGG - Intronic
1150872829 17:68932335-68932357 ATGTCACAAGAGAGAGGAAAAGG - Exonic
1150944453 17:69729867-69729889 CTGTGCAAAGACACAGAAAAAGG - Intergenic
1151423227 17:74012604-74012626 AGGTGACATGACAGAGAAAAGGG + Intergenic
1153182294 18:2448100-2448122 AAGTGACAAGACAAAGAAAAGGG - Intergenic
1153183596 18:2463149-2463171 AAGTGACAAGACAAAGGAAAAGG - Intergenic
1153516286 18:5905127-5905149 TTGTTTCAAGACAGAGAAAGAGG + Intergenic
1153713656 18:7824089-7824111 CTGTGAGATGACAGTGAAAGTGG - Intronic
1155214487 18:23631041-23631063 AGGGGACAAGAAAGAGAAAAGGG - Intronic
1155428912 18:25735283-25735305 TGGTGAGAAGACAAAGAAAAGGG - Intergenic
1156235353 18:35198544-35198566 CAGTGAGAAGACAGCGCAAATGG - Intergenic
1156567592 18:38212720-38212742 ATATGAAAAGGCAGAGAAAATGG + Intergenic
1156773673 18:40761426-40761448 CTGAAAGAAGACAGAGGAAAAGG - Intergenic
1156830982 18:41490859-41490881 CTGTGAGAAAACAAAGAAATCGG + Intergenic
1157110223 18:44813659-44813681 CTGAGGAAAGACAGAGAACATGG + Intronic
1158544556 18:58385193-58385215 ATGTGACAACATGGAGAAAAGGG - Intronic
1158594585 18:58804927-58804949 CTGTGGCAAGACACTGAAATAGG - Intergenic
1158981537 18:62766553-62766575 CTGTGACTAGGTAGAGAAACTGG + Intronic
1159166286 18:64705363-64705385 CTGTGAAATGACAGAGATAATGG + Intergenic
1159849091 18:73504793-73504815 CTGTGATAAGAATGAGAAAAAGG + Intergenic
1159904698 18:74078644-74078666 CTGTGAGGAGAAAGAGGAAAGGG - Intronic
1160132606 18:76241432-76241454 ATCTGACAACACAGATAAAATGG + Intergenic
1160257579 18:77260245-77260267 CTGTGAGGATACAGAGAGAAGGG - Intronic
1161576193 19:5055711-5055733 CTGGGACAAGAATGAGAAGAGGG - Intronic
1162220733 19:9174080-9174102 TTATGATAAGACAGAGAGAAGGG - Intergenic
1162879622 19:13648649-13648671 AAATGACAACACAGAGAAAAAGG - Intergenic
1163196565 19:15725647-15725669 AGGTGAGAACACAGAGAAAAGGG - Intergenic
1163355802 19:16809946-16809968 CTGTGACCAGGCAGATAGAAAGG - Intronic
1164100453 19:22050372-22050394 CAGGGACATGACAGAGAAGAAGG + Intergenic
1165553543 19:36608806-36608828 CTGGGACTAGAAAGTGAAAATGG - Intronic
1166042014 19:40209336-40209358 CTGTGATAAGAATGAGGAAAAGG - Intronic
1166765549 19:45250793-45250815 CTGTGAAGAGATAGAGATAAAGG - Intronic
1166866786 19:45843367-45843389 GTTTCACAAAACAGAGAAAATGG + Intronic
1167644035 19:50696111-50696133 CATTGACAAGACAGAGTAGAAGG + Intronic
1168674826 19:58269914-58269936 CTGTCTCAAAACAGAGCAAATGG + Intronic
925031288 2:651858-651880 CATTAACAATACAGAGAAAATGG - Intergenic
925349129 2:3188886-3188908 CTGGGTCAGGAAAGAGAAAATGG + Intergenic
925819156 2:7782728-7782750 CTAAGACAGGAGAGAGAAAAAGG - Intergenic
926233167 2:11020080-11020102 CTGTTATAAGCAAGAGAAAATGG - Intergenic
926427196 2:12749516-12749538 ATGTAATAAGAGAGAGAAAAGGG - Intergenic
926667092 2:15537435-15537457 ATGTGACTAGACAAAGGAAAGGG - Intronic
927337479 2:21941695-21941717 CTGTGACTACACAAAGAACAGGG + Intergenic
927858103 2:26539936-26539958 CTGTCTCAAGACAAACAAAAAGG - Intronic
928095520 2:28402487-28402509 TTGTGACAAGGCAAAGACAATGG + Intronic
928503481 2:31923682-31923704 ATATGAAAAGACAGAGAGAAAGG + Intronic
928847768 2:35699179-35699201 ATGTGATGAGAAAGAGAAAATGG - Intergenic
928852025 2:35759569-35759591 CTGTGAGAACATAAAGAAAATGG - Intergenic
928936723 2:36686844-36686866 CTTTTAAATGACAGAGAAAAAGG - Intergenic
929243761 2:39679625-39679647 CTGTGAAAGAACAGAGACAAAGG - Intronic
929403206 2:41609953-41609975 CTGTGACCAGAAGGAGAAAATGG - Intergenic
929697481 2:44131449-44131471 AAGTGACTAGACAAAGAAAAAGG - Intergenic
930919133 2:56730091-56730113 CTGTGAAAAGGCACAGAAACAGG - Intergenic
931534451 2:63257580-63257602 CTGAGACAAGGCTGAGAAAAGGG + Intronic
931565564 2:63612651-63612673 ATGTGACAAGACAAAGGAAAAGG - Intronic
931584827 2:63813788-63813810 CTGTGACTGGAGAGAGAATAAGG - Intronic
931674229 2:64677788-64677810 TTGTGAGAAGACAGTGAAAAGGG - Intronic
933672695 2:85024174-85024196 CTGTGAAAAGACGAAGAAAAAGG + Intronic
933767948 2:85723555-85723577 CTGTGAGTAGCCAGAGAAACTGG - Intergenic
934065025 2:88332565-88332587 AAGTTACAACACAGAGAAAACGG - Intergenic
935081975 2:99807249-99807271 ATAGGACAAGGCAGAGAAAACGG + Intronic
935184568 2:100720519-100720541 CTGTGAAAACAAAGAGAAAGAGG - Intergenic
935354050 2:102181706-102181728 ATGTGGGAAGACAGAGGAAAGGG + Intergenic
935360210 2:102239904-102239926 TTGTGGAAAAACAGAGAAAAGGG - Exonic
935541374 2:104353027-104353049 CTGAGGCAGGACAGAGAAGATGG - Intergenic
935694752 2:105761387-105761409 CAGTGACCAGAAAGAGAAACAGG - Intronic
935916028 2:107950739-107950761 TTGTGAGGATACAGAGAAAAGGG + Intergenic
937026034 2:118698416-118698438 TTGTGAACAGCCAGAGAAAAGGG - Intergenic
937102924 2:119285518-119285540 GTGGGATACGACAGAGAAAATGG - Intergenic
937134534 2:119541562-119541584 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
938081723 2:128373772-128373794 GTGTGAGAAGACAGGGAGAATGG - Intergenic
939386089 2:141500251-141500273 ATGTGACAAGACAAAGCAAAGGG - Intronic
939461695 2:142504485-142504507 TCTTTACAAGACAGAGAAAATGG + Intergenic
939585687 2:144002043-144002065 CTATGTCAACACAGTGAAAAAGG - Intronic
939668569 2:144980793-144980815 CTGTAAGAAGATAGAGAAAAAGG - Intergenic
939825832 2:147014742-147014764 AAGTGACAAGACAAAGGAAAAGG + Intergenic
939999711 2:148954882-148954904 CTTTGACATGAAAGAAAAAAAGG + Intronic
940166596 2:150780473-150780495 CTGTGGCAAAGCAGGGAAAAAGG - Intergenic
940181445 2:150938154-150938176 TTGGGGCAAGACAGACAAAACGG + Intergenic
940186551 2:150991509-150991531 TTGTGAGGATACAGAGAAAAGGG + Intergenic
940541063 2:155018709-155018731 ATGTGACAAAATAGAAAAAAAGG - Intergenic
940641316 2:156347128-156347150 CAGAGCCAACACAGAGAAAATGG + Intergenic
940978712 2:159977002-159977024 CTTTGACATTACAGAGCAAATGG - Intronic
941072760 2:160972785-160972807 CTGTGTGAAGAGATAGAAAATGG - Intergenic
941073300 2:160979061-160979083 AAGTGACAAGACAAAGAAAAAGG - Intergenic
941640903 2:167987245-167987267 TTATGATAAGCCAGAGAAAAGGG - Intronic
942123267 2:172799704-172799726 ATGTGACAAAAGAGAGGAAAGGG + Intronic
942507153 2:176655243-176655265 CTGGGACAATACAGTTAAAAAGG - Intergenic
942841395 2:180365957-180365979 CTGTGTCATGAGACAGAAAATGG + Intergenic
943983413 2:194587700-194587722 CTGTGAAAAGAAAGAAAGAAAGG + Intergenic
944070795 2:195666367-195666389 CAGTGACAAGACACTGAAAAAGG + Intronic
944518096 2:200532412-200532434 CTGTGACTGGGCAGAGGAAAAGG - Intronic
944953083 2:204775618-204775640 CTGTATTATGACAGAGAAAATGG - Intronic
945036954 2:205712154-205712176 CTGTGAGGAGACAAATAAAAAGG + Intronic
945077218 2:206051842-206051864 GTGTGTCAACACAGTGAAAAAGG - Intronic
945655487 2:212617570-212617592 CCATGACAAAAAAGAGAAAACGG + Intergenic
945754875 2:213833791-213833813 CTATGAAGAGACAGAGGAAATGG - Intronic
946106764 2:217377357-217377379 CTGGGACATGACAGATATAATGG + Intronic
946977847 2:225173533-225173555 CTGTGACAAGACAAATAACTGGG - Intergenic
946978054 2:225175149-225175171 CTGTGACAAGACAAATAACTGGG + Intergenic
947891142 2:233621682-233621704 CTTTAAAAAGACAGAAAAAAGGG - Intronic
947969835 2:234313698-234313720 TGGTGAAAAGAAAGAGAAAAGGG - Intergenic
1169498321 20:6135342-6135364 CTGTCACAGGAGAGAGAAATGGG + Intergenic
1171200102 20:23233876-23233898 TTAAGACAAGAAAGAGAAAAGGG - Intergenic
1171286891 20:23947205-23947227 CTGTGAGGCTACAGAGAAAAGGG - Intergenic
1171528980 20:25839100-25839122 CTGTCTCAAGACAAAAAAAAAGG - Intronic
1171547846 20:26016785-26016807 CTGTCTCAAGACAAAAAAAAAGG + Intergenic
1172315150 20:33948202-33948224 GGGAGACAAGACAGAGAAAGTGG + Intergenic
1172813609 20:37669449-37669471 AGGTGAGAAGACAGGGAAAAAGG - Intergenic
1173394323 20:42664282-42664304 ATGTGACAAAACTGAGAAAAGGG - Intronic
1173779494 20:45742909-45742931 CTGTGACAACACAACAAAAACGG + Intergenic
1174127377 20:48316918-48316940 CTGAGTCAAGACAGAGAAGAAGG + Intergenic
1174253796 20:49238965-49238987 CCGGGACAAGATTGAGAAAATGG + Exonic
1174307650 20:49625784-49625806 CTCTGTCAACACAGAGGAAAAGG - Intergenic
1175002883 20:55648936-55648958 CTTAGACAAGACAGAGGAGAAGG - Intergenic
1175624365 20:60478167-60478189 CTGTGTCAGGAGAGAGAGAAAGG - Intergenic
1177216422 21:18135602-18135624 CTGTGACATCTCAGAGATAATGG - Intronic
1177495736 21:21889025-21889047 TGGTGACGAGGCAGAGAAAAGGG - Intergenic
1178688792 21:34733424-34733446 CTGGGACCAGATATAGAAAACGG - Intergenic
1179198140 21:39184410-39184432 CTGTTTCAAGCAAGAGAAAAAGG + Exonic
1179505674 21:41838670-41838692 CTGTGAATAGGCAGAGAAGATGG - Intronic
1179554125 21:42161972-42161994 CTGAGAGAAGACAGAGGAAGTGG + Intergenic
1180059992 21:45379826-45379848 CTGAATCAAGACAGAGGAAATGG - Intergenic
1181283287 22:21735316-21735338 CCGTGAAAAGATAGGGAAAATGG - Intronic
1181410850 22:22718030-22718052 CTCTCACAAAACAGAGCAAATGG - Intergenic
1181972142 22:26698974-26698996 CTGTGAACAGACCAAGAAAAGGG - Intergenic
1182973970 22:34605120-34605142 TAGTGACAAGAAAGGGAAAATGG - Intergenic
1183884333 22:40865101-40865123 TTGTGAAGAGGCAGAGAAAATGG - Intronic
1185130907 22:49038082-49038104 CTGTAGAAAGACAGAGGAAACGG - Intergenic
949181540 3:1137076-1137098 GTGTGACAAGATAGAAAAATAGG - Intronic
949449472 3:4169412-4169434 ATGTGAAGACACAGAGAAAAGGG + Intronic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
949717780 3:6953237-6953259 CAGTTAGAAGACAGAGAAGAGGG + Intronic
950013053 3:9736987-9737009 GTGTGTCATGGCAGAGAAAAGGG + Intronic
950166862 3:10807554-10807576 CTGTGAGGACACAGGGAAAAAGG - Intergenic
950555556 3:13693715-13693737 CTGTTACAAGCAACAGAAAATGG - Intergenic
950598942 3:14013957-14013979 ATTTCACAAGACAGAGAAAGAGG - Intronic
950680852 3:14584171-14584193 CTGTGACAAGCTGGAGAGAAAGG + Intergenic
951252372 3:20409104-20409126 CTGTGTAGAGACAGTGAAAAAGG + Intergenic
951931111 3:27968268-27968290 CAGTGAGAAGACAGAGAGTAAGG - Intergenic
952531291 3:34264598-34264620 CTGTGACAGAACAGAAAATATGG + Intergenic
953452339 3:43015433-43015455 CTGTGTGAAGACACAGAAAGGGG + Intronic
953744512 3:45563785-45563807 CTGTTACAAGCAATAGAAAATGG + Intronic
955558354 3:60162103-60162125 CTGTGAGGAGACAGAGGAAGGGG + Intronic
956473239 3:69591670-69591692 CTTTGACAAAAAAGAGCAAATGG + Intergenic
956834865 3:73088635-73088657 CTGAGAGAAGAGAGAGAAAGTGG + Intergenic
956901397 3:73719852-73719874 GAGAGACAAGAGAGAGAAAAAGG + Intergenic
956959245 3:74378938-74378960 CTAAAACAAGAGAGAGAAAAAGG - Intronic
957385179 3:79487046-79487068 GAGTGACAAGACAAAGGAAAAGG - Intronic
957392835 3:79600436-79600458 GTGAGAGAACACAGAGAAAAGGG + Intronic
957533717 3:81473796-81473818 CAGTGAAATGACAGTGAAAATGG - Intergenic
959044796 3:101462085-101462107 CTGAAACTAGACAGAGAAAGTGG + Intronic
959231472 3:103658551-103658573 TTGTGAAAAGGCAGAGTAAATGG - Intergenic
959354196 3:105304653-105304675 CTCCCACATGACAGAGAAAAGGG + Intergenic
959412680 3:106045130-106045152 CTGTTACAAGCAACAGAAAATGG - Intergenic
959604369 3:108225821-108225843 AAGTGACAAGACAAAGGAAAAGG + Intergenic
960510348 3:118541787-118541809 CTCTGCCAGGACAGAGAGAAAGG - Intergenic
960820333 3:121724033-121724055 CTGTTACACGCAAGAGAAAACGG + Intronic
961315523 3:126032854-126032876 CTGTGACAGCACTGAGAATATGG - Intronic
961389585 3:126544394-126544416 CTGTTACAAGTAACAGAAAAGGG + Intronic
961413780 3:126742849-126742871 CTGTTATAAGCAAGAGAAAATGG + Intronic
961557110 3:127703262-127703284 CTGTGAGAAGGCAGAGAATGTGG - Intronic
961587327 3:127943323-127943345 TGTTGACAATACAGAGAAAAGGG - Intronic
962024234 3:131530115-131530137 CAGTGTCAATATAGAGAAAAAGG - Intergenic
962622599 3:137194702-137194724 ATGTGGCAAGGCAGAGAAAGTGG - Intergenic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
962915998 3:139904280-139904302 CTGTGAGAACATAAAGAAAAAGG + Intergenic
963217722 3:142769283-142769305 CAGTGACAAAAAAGAGCAAAGGG - Intronic
963931465 3:151008364-151008386 ATGTGGAAAGACAGAAAAAAAGG - Intergenic
964146009 3:153464251-153464273 CTGTGATAAGCAACAGAAAATGG + Intergenic
964403694 3:156326344-156326366 CTCTGCCTAGACAGAGATAATGG - Intronic
964501852 3:157356581-157356603 TTTTGATAAGACAGAGGAAAAGG - Intronic
965297145 3:166962448-166962470 CTGTGAAAACACAGAGAAGTTGG - Intergenic
965904715 3:173689495-173689517 CTGAGATCAGAAAGAGAAAATGG + Intronic
966143532 3:176784577-176784599 TGGTGGAAAGACAGAGAAAATGG - Intergenic
967183776 3:186928855-186928877 CTGTAACAAGACAGAAGAAAAGG - Intergenic
967343087 3:188422727-188422749 CTGAATGAAGACAGAGAAAAGGG - Intronic
967401584 3:189068769-189068791 CTGTCTCAAAAAAGAGAAAAAGG + Intronic
967547452 3:190748685-190748707 CTGTTACAAGTGAGAGGAAATGG + Intergenic
967750804 3:193114423-193114445 CTGAGTCAAAACAGAGAAATTGG - Intergenic
967763359 3:193250647-193250669 CTGGCACAAGCCAGAGGAAAAGG + Intronic
969110106 4:4839194-4839216 CCGAGACCAGACAGAAAAAAAGG + Intergenic
969252452 4:5977045-5977067 GTGAGACATGACAGAAAAAAGGG + Intronic
969361767 4:6668803-6668825 CTGTGCAAAGACATAGAAAGTGG - Intergenic
970186987 4:13466552-13466574 CAGTGAGAATATAGAGAAAAGGG + Intronic
970415069 4:15848516-15848538 CTATGACAAGAAAGCAAAAAAGG - Intronic
971013098 4:22460588-22460610 AAGTGACAAGACAAAGGAAAAGG - Intronic
971881943 4:32386821-32386843 CTGAAAGAAGACAAAGAAAAGGG + Intergenic
972691711 4:41405004-41405026 AATTGACAAGACAGAAAAAATGG - Intronic
973655472 4:53043256-53043278 CAGTGACAAGTGAAAGAAAAGGG + Intronic
973723832 4:53752214-53752236 CTATGTCAAGAGAAAGAAAAGGG + Intronic
974062950 4:57052164-57052186 CAATGAGAAGACAGAGAAAAGGG + Intronic
974583117 4:63832723-63832745 CTTTGACTATACACAGAAAATGG - Intergenic
974710141 4:65581163-65581185 AAGTGACAAGACAAAGGAAAAGG - Intronic
975534861 4:75439009-75439031 CTGACACAAGACAGAGCAAGAGG + Intergenic
975581328 4:75909463-75909485 AAGTGACAAGACAAAGGAAAAGG - Intergenic
975591396 4:76003700-76003722 CTGTGAGAAGAAGGGGAAAAAGG + Intronic
975683804 4:76900195-76900217 CTGGGACAAGAGAGAGAGAGAGG - Intergenic
975826661 4:78326919-78326941 TTATGACATGACAGGGAAAAGGG + Intronic
976921672 4:90450729-90450751 CTGGGACTAGAGAGAGAGAAAGG + Intronic
978144578 4:105356809-105356831 CTGTGATAACAAAGAGCAAAGGG + Intergenic
978439269 4:108716556-108716578 CTGGGACCAGACAACGAAAATGG - Intergenic
978527593 4:109681251-109681273 TTGTGACAAGTCAAAGGAAAAGG + Intronic
978552774 4:109945735-109945757 AAGTGACAAGACAGAGGAAAAGG + Intronic
979289568 4:118965068-118965090 TTATGCCAAGACAGAGATAAAGG - Intronic
979753739 4:124312944-124312966 CTGTGAGAAGAAAAACAAAAAGG - Intergenic
979891328 4:126098893-126098915 CTGTGAAAAGATAGAGAGCAGGG + Intergenic
980081446 4:128349030-128349052 CTGTGAAAAAACAGAAAGAATGG - Intergenic
980480481 4:133380500-133380522 CAGTGACAATACAGATAGAAAGG - Intergenic
982403518 4:154995414-154995436 ATGTGGCAAGTCAGTGAAAAGGG - Intergenic
982433916 4:155358930-155358952 TGGTGAGAACACAGAGAAAAGGG + Intronic
982858302 4:160413975-160413997 GAGTGAGATGACAGAGAAAATGG - Intergenic
983670240 4:170228751-170228773 CTGTGACTAGAAAGACAGAAAGG + Intergenic
983683296 4:170377466-170377488 CTTTGAAAGGACAAAGAAAATGG + Intergenic
984510816 4:180676638-180676660 CTGTTATAAGCCACAGAAAATGG - Intergenic
984964717 4:185129734-185129756 CTGTGAAAAAAGAAAGAAAAGGG - Intergenic
984996599 4:185437163-185437185 CTGTGAGTAGACAGAGTGAAAGG + Intronic
986882636 5:12194099-12194121 CTGTTACAAGCAACAGAAAATGG - Intergenic
987027190 5:13939514-13939536 CTGTGGGAAGACAGGGAAACAGG - Intronic
987672757 5:21033835-21033857 CTGTCACAAAAAAGATAAAAAGG + Intergenic
987973706 5:24984028-24984050 GTGTGCCAAGAAAGAGGAAAAGG + Intergenic
988715656 5:33824742-33824764 GTGTGACCAGAAAGAGGAAATGG - Intronic
988868070 5:35357149-35357171 CTGTGACAAAATGGAGAAGAAGG - Intergenic
989004336 5:36793360-36793382 CTGTAAAAAGACAAAGAAACAGG + Intergenic
989301461 5:39899077-39899099 CATTGACAAGCCAAAGAAAAAGG + Intergenic
990515121 5:56523903-56523925 CTGTAAGAAGGCAGAGAAAGAGG - Intronic
990989370 5:61670243-61670265 CAGAAACAAGAGAGAGAAAAGGG + Intronic
991029841 5:62071361-62071383 GTGTGCCAAGACTGGGAAAATGG + Intergenic
991069602 5:62462293-62462315 CTGTGACAAGACTGAATAAAAGG - Intronic
991559515 5:67934817-67934839 CTGTGACCAGGCAGAGAGCAGGG - Intergenic
992484891 5:77185172-77185194 GTGTGTCCAGAAAGAGAAAATGG + Intergenic
992515072 5:77483075-77483097 GAGTGACAAGACAAAGGAAATGG - Intronic
992610265 5:78501947-78501969 CAGAGACAAGCAAGAGAAAAAGG + Intronic
993074551 5:83212506-83212528 CTGGGACAAAAGAGAGAGAAAGG + Intronic
994146572 5:96402147-96402169 CTGTGACAAGAAAGAGGCAGTGG + Intronic
994848703 5:105024770-105024792 CCTAGAAAAGACAGAGAAAATGG + Intergenic
994974674 5:106787204-106787226 TTGTGAAAAGCCAGAGAAAGGGG - Intergenic
995085152 5:108099919-108099941 CTGTGAAAAGATCAAGAAAATGG - Intronic
995531818 5:113098897-113098919 CTGTGACAGTACAGAGTACAAGG - Intronic
995980918 5:118103220-118103242 CAGTGCCATGACAAAGAAAATGG + Intergenic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
996135437 5:119836224-119836246 ATGTGAGAAGACAGAGATTAGGG - Intergenic
996401532 5:123068587-123068609 CAGTGCCAAGACAGACAAAAAGG - Intergenic
996669211 5:126097400-126097422 ATGTGACATGAGAGAGAAGAGGG - Intergenic
996753780 5:126915320-126915342 TTGTGACAACACAAAGAAATAGG + Intronic
997449845 5:133973440-133973462 CTGTAAAAAGACAAAGAAATAGG - Intronic
998502730 5:142647350-142647372 AAGTGACAAGACAAAGGAAAAGG - Intronic
998740838 5:145199556-145199578 CTGTGACCAGCCAGAAAAAATGG - Intergenic
998794096 5:145799075-145799097 CTGTCAAAAGTCACAGAAAAAGG + Intronic
999314471 5:150575143-150575165 CTGTGGCCAGACAGAGAGCAGGG - Intergenic
1000006491 5:157189674-157189696 CTGTCACAAAACAGAAAAAAAGG + Intronic
1000366361 5:160494845-160494867 ATGTGACAAGACACGGGAAAGGG - Intergenic
1000849347 5:166320798-166320820 CTCTGCCAAGACTGAGAAATCGG - Intergenic
1001536715 5:172503234-172503256 CTGGGAGAAGAAAGAGAAGATGG - Intergenic
1001642888 5:173257706-173257728 CTGTGCTAAGACAGAGCCAATGG + Intergenic
1001689302 5:173620865-173620887 CTGATACAATACAGAGAAAAAGG + Intergenic
1001715228 5:173810136-173810158 CTGGAACAAAACAGAGAAAAAGG - Intergenic
1001851772 5:174973935-174973957 CTGTGACGAGTGAGAGAACACGG - Intergenic
1003023429 6:2531481-2531503 CTGAGACAAGACTTAGAAGAGGG - Intergenic
1003106872 6:3223991-3224013 GTGTGTGAAGAAAGAGAAAAAGG + Intergenic
1003295832 6:4827050-4827072 CTGTAACAAGACACAAAAGATGG - Intronic
1003613334 6:7632589-7632611 CTGAGACCACACAGAGAGAAAGG + Intergenic
1004301816 6:14465487-14465509 CTGACAAAAGACAGAGAAACAGG - Intergenic
1005762789 6:28982948-28982970 CTGTCACAAAACTGAGAAACAGG + Intergenic
1006226214 6:32538810-32538832 CTGTCACAGGACCTAGAAAAGGG - Intergenic
1007833021 6:44653310-44653332 CAGTGACAAGACAGAGAGCCTGG - Intergenic
1007999202 6:46340966-46340988 ATGTGTCAAGACAGAGACCAAGG + Intronic
1008455215 6:51702811-51702833 CTGTTAAAAGAGAAAGAAAAAGG + Intronic
1008842056 6:55914523-55914545 CTGGGTCAAGACAGAGACATAGG + Intergenic
1009213248 6:60888356-60888378 CTGTAAGTAGACAGAGAAATGGG + Intergenic
1009298766 6:61988542-61988564 TAATGACAAGACACAGAAAATGG + Intronic
1010287523 6:74096466-74096488 CTGGGATAAGAAAGTGAAAATGG + Intergenic
1010355579 6:74928665-74928687 CTGTGGGATGACAGAGAACAGGG + Intergenic
1010516801 6:76783232-76783254 CGGTGAGAATACAGAGAAAGCGG + Intergenic
1010877800 6:81129781-81129803 CTATGTAAAGACAGAGAAATGGG - Intergenic
1010976976 6:82326145-82326167 CTGTGAGAACAAAGAGAACAGGG - Intergenic
1011508267 6:88071988-88072010 CTGAGGAAAGACAGAGACAAGGG - Intergenic
1012169676 6:96002481-96002503 CTGTGGCAAGACACAGAGTAGGG - Intergenic
1012865896 6:104617342-104617364 CTGTTACAAGCAACAGAAAATGG + Intergenic
1013456460 6:110334092-110334114 CTGAGAGAAAACAGAGGAAAGGG + Intronic
1014609287 6:123521409-123521431 CTGTGAAAAGACAGAGACACAGG + Intronic
1016011664 6:139143463-139143485 CTATGATAAGAAAGAGAAGATGG - Intronic
1016137746 6:140567055-140567077 CTGTGACTAGAGAGACAAAATGG - Intergenic
1016282900 6:142439524-142439546 CAGTGGCAAGACATAGAAAACGG - Intronic
1016469754 6:144362662-144362684 CTTTGCCAAGACATGGAAAAAGG + Intronic
1016916498 6:149248827-149248849 CTGTGACAAGACAGAGAAAATGG - Intronic
1017588396 6:155951856-155951878 CTGTGAGAGGACAGAGATGAAGG + Intergenic
1018168232 6:161120796-161120818 CTCTGAGAAAACAGAGAAGAGGG - Intergenic
1019374687 7:683152-683174 CTGTGACAAGGCTGAGACCACGG + Intronic
1020473627 7:8568495-8568517 CTGTGAAAAGAAACAAAAAATGG - Intronic
1020494592 7:8833444-8833466 CTGTGAGAATACAGAGCGAACGG - Intergenic
1020733487 7:11914761-11914783 CTGTGAAGAGAAAGAGCAAAGGG + Intergenic
1021149271 7:17129317-17129339 CTGTTACAAGGAACAGAAAACGG + Intergenic
1021217041 7:17929183-17929205 CAGTGACAAGAAAGAAAAGATGG + Intronic
1022030134 7:26485183-26485205 CAGTTACATCACAGAGAAAATGG - Intergenic
1022295405 7:29046655-29046677 CTATAACCAGACAGAGAAAAGGG + Intronic
1023040832 7:36172044-36172066 CACTGACAAGACAGAGAAAAAGG - Intronic
1024256528 7:47543947-47543969 CTGTGACGAGTCAGAGCAGAGGG - Intronic
1024696671 7:51864415-51864437 GTGTGACAGGAGAGAGAGAATGG + Intergenic
1024871217 7:53963333-53963355 TTGTCACAAGACAAAGGAAAAGG - Intergenic
1024871298 7:53964367-53964389 AAGTGACAAGACAAAGGAAAAGG + Intergenic
1024960269 7:54967483-54967505 CTGTCGCAATACAGAGAAATGGG - Intergenic
1025009153 7:55381836-55381858 CAGTGACAAGACAAAGGACAGGG + Intronic
1025038371 7:55617698-55617720 TTGTGAGAATGCAGAGAAAAGGG - Intergenic
1025770840 7:64504686-64504708 CTCTGCAAAGACACAGAAAAAGG + Intergenic
1025888068 7:65617687-65617709 CTGAGCCAATCCAGAGAAAATGG - Intergenic
1026296606 7:69058403-69058425 CTGTGACAAGACAGTGACGCTGG + Intergenic
1027462642 7:78474291-78474313 TTGTGTAAAGACAGTGAAAAAGG + Intronic
1027599950 7:80227719-80227741 CTGTGACAATAGAGATAAACTGG - Intergenic
1027842374 7:83329644-83329666 CACTGATAAGATAGAGAAAAAGG + Intergenic
1028496337 7:91464847-91464869 CTGTGTCTAGAGAAAGAAAATGG - Intergenic
1028813524 7:95117589-95117611 CTGAGTCTAGGCAGAGAAAATGG + Intronic
1029053461 7:97714640-97714662 ATTTCACAAGATAGAGAAAAAGG + Intergenic
1029542029 7:101189275-101189297 CAGTGAAAAGACAGAAAGAAAGG + Intergenic
1030224975 7:107140051-107140073 CTTTGAAAAGACAGAATAAATGG - Intronic
1030409451 7:109157191-109157213 CTGTGACAATGCATTGAAAAAGG + Intergenic
1030565949 7:111156017-111156039 CTATGACAACACAAAGAACATGG - Intronic
1030772540 7:113492145-113492167 GTGTGGCAAGAAAGGGAAAAGGG - Intergenic
1030879610 7:114861333-114861355 CTGTTATAAGCAAGAGAAAAAGG + Intergenic
1031131205 7:117835529-117835551 AAGTGACTAGAGAGAGAAAAGGG - Intronic
1031217442 7:118913508-118913530 CTGTAACATGACAGAATAAATGG - Intergenic
1031349222 7:120708158-120708180 CAGTGACAAGTAAAAGAAAATGG + Intronic
1032142104 7:129341220-129341242 AAGTGACAAGACAAAGGAAAAGG + Intronic
1032577376 7:133069569-133069591 GTGTGGCAGGAGAGAGAAAAGGG + Intronic
1032912230 7:136446452-136446474 CTGGGACATGAAATAGAAAAAGG - Intergenic
1033705259 7:143880499-143880521 TTGTATAAAGACAGAGAAAATGG - Intronic
1033838954 7:145350391-145350413 CTGTAAGATGAGAGAGAAAATGG - Intergenic
1034252711 7:149705193-149705215 CTGGGAAAGGAAAGAGAAAAAGG - Intergenic
1034707444 7:153158344-153158366 CAGTGACAAGACAAAGGAGAGGG + Intergenic
1034724569 7:153323304-153323326 GTGTGACCAGCCAGATAAAAAGG + Intergenic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035342867 7:158175483-158175505 CTGTGTTAAGACAGAGACAGAGG - Intronic
1035576773 8:713074-713096 CTGTGACAACTGAGAGAGAACGG - Intronic
1035641190 8:1186379-1186401 CTGTGACCAGGCAGAGAAACGGG + Intergenic
1035948108 8:3987660-3987682 CAGTTCCCAGACAGAGAAAATGG + Intronic
1037539852 8:19860515-19860537 TTGTGACAAGATAAAGGAAAGGG - Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1038146893 8:24905469-24905491 GGTTGACAAGACAGAGAACATGG - Intergenic
1038912700 8:31984560-31984582 CAGTGTCCAGACACAGAAAATGG - Intronic
1040412218 8:47166126-47166148 CTATGAGAAAACAGAGTAAATGG - Intergenic
1040786333 8:51168638-51168660 TTGTGTCAAGACACAGATAAAGG - Intergenic
1040920103 8:52606572-52606594 CTGTGAGTAGACAAAGACAAAGG + Intergenic
1041397025 8:57401899-57401921 CTGAGGCAAGCCATAGAAAATGG - Intergenic
1041609442 8:59827773-59827795 GTATGTCAAGAAAGAGAAAAAGG - Intergenic
1041752659 8:61277871-61277893 AAGTGACAAGACAAAAAAAAAGG + Intronic
1042255330 8:66796831-66796853 CAGGGACAAGACAGACAATAAGG + Intronic
1042329966 8:67568332-67568354 CTATGAAATGACAGAAAAAATGG + Intronic
1042772480 8:72394590-72394612 CTGTCACAGGACCTAGAAAAAGG - Intergenic
1042826066 8:72980788-72980810 CAGTAAGAGGACAGAGAAAAAGG - Intergenic
1042846543 8:73174536-73174558 CTCAGACAAGCCAGAGGAAAGGG + Intergenic
1043271911 8:78344665-78344687 ATGGGACAAGAGAGAGAAAATGG + Intergenic
1043588420 8:81796749-81796771 CTGTGACAAGCCTGAGGGAAGGG - Intergenic
1044022437 8:87122200-87122222 TGGTGAGAATACAGAGAAAAGGG - Intronic
1044787502 8:95809996-95810018 CTGTGAAAGAAGAGAGAAAAGGG - Intergenic
1044789163 8:95828910-95828932 CTGAGAGAAGAAAGATAAAAGGG + Intergenic
1044823774 8:96177521-96177543 CTGTGTCACTAGAGAGAAAAAGG - Intergenic
1044930803 8:97249774-97249796 CTGTGATGAGTCAGAGAAAGAGG + Intergenic
1045555010 8:103207396-103207418 AAGTGACAAGACAAAGGAAAAGG + Intronic
1047539840 8:125754140-125754162 CCTGGAGAAGACAGAGAAAAGGG - Intergenic
1047556424 8:125936487-125936509 AAGTGACAAGACAGAGGAAAGGG + Intergenic
1047773148 8:128046737-128046759 CATTTAGAAGACAGAGAAAAGGG - Intergenic
1048120152 8:131571165-131571187 ATTTCACAAGACAGAGAAAGAGG - Intergenic
1048717229 8:137283380-137283402 CAGTTACATGAGAGAGAAAAAGG - Intergenic
1048729759 8:137425275-137425297 ATGGGACAGTACAGAGAAAAAGG + Intergenic
1051942374 9:22523543-22523565 TTTTGATAAGACAGAGGAAAGGG - Intergenic
1052295554 9:26893128-26893150 CTATGACAATAAAGAGAATAGGG + Intergenic
1054765561 9:69039762-69039784 CTGTCACAAGCAACAGAAAATGG - Intronic
1054957557 9:70929894-70929916 CTGTTAGAAGACAGCGAAACTGG + Intronic
1055126798 9:72728216-72728238 AAGTGACAAGACAAAGGAAAAGG + Intronic
1055818003 9:80230575-80230597 CTGTCTCAAGAAAAAGAAAACGG - Intergenic
1056215976 9:84406403-84406425 CTTTGTCAAGACAGAGCAACAGG + Intergenic
1059042745 9:110831472-110831494 CTGGGAGAAGACAGACAGAATGG + Intergenic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1060960447 9:127677012-127677034 CTGAGACAAGACAGATAAAATGG - Intronic
1185774087 X:2788077-2788099 CTGTCTCAAGAGAGAGAGAAAGG + Intronic
1186790280 X:12990673-12990695 CTGTCATAAGCCACAGAAAATGG + Intergenic
1186957780 X:14702030-14702052 CTGTGTCAAGACCCAGACAAAGG - Intronic
1187080489 X:15981665-15981687 AAGTGACAAGACAAAGGAAAAGG + Intergenic
1187437241 X:19283824-19283846 CTGTGTCATCAAAGAGAAAATGG + Intergenic
1187625517 X:21108461-21108483 CAATGACAAGACAAAGAAAAAGG - Intergenic
1188275827 X:28199251-28199273 GTGTGAGAAGACAGAGAATTTGG - Intergenic
1188618161 X:32185012-32185034 CTGTGACAAGAAATATAAACTGG + Intronic
1188893780 X:35642367-35642389 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
1192093300 X:68183637-68183659 ATGTGACAAGACAAAGTAAAAGG - Intronic
1192267428 X:69548448-69548470 CTCTGACAATGAAGAGAAAATGG + Intergenic
1192903068 X:75521325-75521347 ATGTGAGAAGACAGGGACAAGGG + Intronic
1194183841 X:90746898-90746920 GAGTCACAGGACAGAGAAAAGGG + Intergenic
1194438346 X:93897372-93897394 CAGAGATAAAACAGAGAAAATGG - Intergenic
1195269596 X:103216124-103216146 AGGAGACAAGAGAGAGAAAATGG - Intronic
1195594819 X:106675627-106675649 CTGTGACCAAAGAGAGGAAATGG + Intronic
1195656631 X:107337548-107337570 CTGTCACAAGACGTAGAAGAAGG - Intergenic
1195669386 X:107456730-107456752 CTGTGACAAGTCAAAGAGAGAGG - Intergenic
1195866042 X:109433985-109434007 CTGTGATAAGAAAGAAAAGATGG + Intronic
1195910881 X:109887399-109887421 CAGTGTCAAGGGAGAGAAAAAGG - Intergenic
1195967957 X:110446165-110446187 CTGTGAACAGACAGAGGAATGGG + Intronic
1195986553 X:110636934-110636956 CTGTGACCTGGTAGAGAAAAAGG + Intergenic
1196181230 X:112692609-112692631 AAGTGACAAGACAAAGAAAGAGG + Intergenic
1196279991 X:113812760-113812782 AAGTGACAAGACAAAGGAAAAGG - Intergenic
1197015357 X:121619112-121619134 CTGTGAAAGGACAAAAAAAATGG - Intergenic
1197406267 X:126055202-126055224 ATGTGTAAAGACAGAGACAAGGG - Intergenic
1197495266 X:127172078-127172100 CTCAAACAAGAGAGAGAAAAGGG + Intergenic
1197658738 X:129146851-129146873 ATGGGAGAAGAAAGAGAAAAAGG + Intergenic
1198194326 X:134344789-134344811 CTGTGAAAAGACAAAGACAAGGG + Intergenic
1198337655 X:135682795-135682817 ATCAGACAAGACAAAGAAAAAGG + Intergenic
1199275149 X:145932551-145932573 CTGTTTACAGACAGAGAAAATGG - Intergenic
1199638784 X:149839862-149839884 CTTTGAAAAGATAAAGAAAATGG - Intergenic
1201260502 Y:12154430-12154452 CTGGGACAATACAGGAAAAAAGG - Intergenic
1202099420 Y:21290704-21290726 TGGTGATAACACAGAGAAAAAGG + Intergenic
1202297717 Y:23377346-23377368 ATGTGATAATACAGACAAAATGG + Intergenic
1202573092 Y:26293251-26293273 ATGTGATAATACAGACAAAATGG - Intergenic