ID: 1016916500

View in Genome Browser
Species Human (GRCh38)
Location 6:149248851-149248873
Sequence AGCAGTCATGTCCCCACCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016916497_1016916500 5 Left 1016916497 6:149248823-149248845 CCTGCCATTTTCTCTGTCTTGTC 0: 1
1: 1
2: 4
3: 44
4: 465
Right 1016916500 6:149248851-149248873 AGCAGTCATGTCCCCACCCCCGG No data
1016916498_1016916500 1 Left 1016916498 6:149248827-149248849 CCATTTTCTCTGTCTTGTCACAG 0: 1
1: 0
2: 6
3: 66
4: 574
Right 1016916500 6:149248851-149248873 AGCAGTCATGTCCCCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016916500 Original CRISPR AGCAGTCATGTCCCCACCCC CGG Intronic
No off target data available for this crispr