ID: 1016918806

View in Genome Browser
Species Human (GRCh38)
Location 6:149270944-149270966
Sequence CTGGGTAGTCAGAGGGTTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016918800_1016918806 -4 Left 1016918800 6:149270925-149270947 CCACTGCTGTTGCAAAAAACTGG 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1016918806 6:149270944-149270966 CTGGGTAGTCAGAGGGTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016918806 Original CRISPR CTGGGTAGTCAGAGGGTTAC GGG Intronic
No off target data available for this crispr