ID: 1016918806 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:149270944-149270966 |
Sequence | CTGGGTAGTCAGAGGGTTAC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1016918800_1016918806 | -4 | Left | 1016918800 | 6:149270925-149270947 | CCACTGCTGTTGCAAAAAACTGG | 0: 1 1: 0 2: 2 3: 15 4: 194 |
||
Right | 1016918806 | 6:149270944-149270966 | CTGGGTAGTCAGAGGGTTACGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1016918806 | Original CRISPR | CTGGGTAGTCAGAGGGTTAC GGG | Intronic | ||
No off target data available for this crispr |