ID: 1016919577

View in Genome Browser
Species Human (GRCh38)
Location 6:149278726-149278748
Sequence AAGGAGAAGTAGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3782
Summary {0: 1, 1: 2, 2: 33, 3: 468, 4: 3278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016919573_1016919577 18 Left 1016919573 6:149278685-149278707 CCAGCTTATAAAACTCTCTTATC 0: 1
1: 0
2: 1
3: 13
4: 223
Right 1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG 0: 1
1: 2
2: 33
3: 468
4: 3278
1016919571_1016919577 22 Left 1016919571 6:149278681-149278703 CCCTCCAGCTTATAAAACTCTCT 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG 0: 1
1: 2
2: 33
3: 468
4: 3278
1016919572_1016919577 21 Left 1016919572 6:149278682-149278704 CCTCCAGCTTATAAAACTCTCTT 0: 1
1: 0
2: 1
3: 21
4: 228
Right 1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG 0: 1
1: 2
2: 33
3: 468
4: 3278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016919577 Original CRISPR AAGGAGAAGTAGAGGAAGGA AGG Intronic
Too many off-targets to display for this crispr