ID: 1016920414

View in Genome Browser
Species Human (GRCh38)
Location 6:149287614-149287636
Sequence CGGCCCTGTGTTTTGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016920414_1016920416 16 Left 1016920414 6:149287614-149287636 CCAGCAGACAAAACACAGGGCCG 0: 1
1: 0
2: 0
3: 12
4: 107
Right 1016920416 6:149287653-149287675 TACTGAACTTGTTTTCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016920414 Original CRISPR CGGCCCTGTGTTTTGTCTGC TGG (reversed) Intronic
903692785 1:25186032-25186054 CGGCTCTGTGTTTGCTCTGGGGG - Intergenic
910538362 1:88325853-88325875 CAGCTCTGTGGTTCGTCTGCAGG - Intergenic
915296688 1:154926289-154926311 CCACCCTGTGGTTTGTCTACCGG - Intronic
919740214 1:200976838-200976860 CGGCCCTGTGATGTGCCTGACGG - Exonic
923508133 1:234624487-234624509 AAGCCCTGTGCTTTATCTGCTGG - Intergenic
923576493 1:235163269-235163291 CGGCCCTGGGTTTTGATTACTGG + Intronic
1065588859 10:27245952-27245974 CGGCCCTGTGCTTCCTCCGCCGG + Intergenic
1068119303 10:52770202-52770224 CGGCCATGTGATTTCTCTGCTGG - Intronic
1070595811 10:77832406-77832428 CGGCCCTGGGGCCTGTCTGCTGG - Intronic
1070627692 10:78062881-78062903 CAGCCCTGAGCTTTCTCTGCAGG + Intergenic
1072617663 10:97060204-97060226 CAGCCCTGGGTGTTATCTGCTGG + Intronic
1074808190 10:117075290-117075312 CTGCCCTGAGTTTTGTCTCTTGG + Intronic
1075020524 10:118948819-118948841 GGGCCCTGTTCTTTGGCTGCTGG - Intergenic
1075223176 10:120601913-120601935 CTGCCCTCTGTTCTGCCTGCTGG + Intergenic
1076320047 10:129571756-129571778 CCGCCGTGTGTTTTATTTGCTGG + Intronic
1077239324 11:1502434-1502456 CGGCCCTGCTTTTTGTCCCCAGG + Intergenic
1081505173 11:43708979-43709001 CTGCCCTGTGTTTTCTCCACTGG - Intronic
1084520427 11:69659294-69659316 CGGCACTGTGTCTTGGCTGCTGG + Intronic
1084765107 11:71303171-71303193 CTGCCCAGTGTCTTGGCTGCTGG + Intergenic
1087649376 11:100846989-100847011 AAGCCCTGTGTTTTGTGTGCTGG - Intronic
1089682559 11:120127335-120127357 CGACTCTGTGTTGTTTCTGCAGG - Exonic
1090777354 11:129977156-129977178 GGGCACTGTGCTCTGTCTGCTGG - Intronic
1096139071 12:49227266-49227288 CGGCCTTGGTTTTTTTCTGCAGG - Intronic
1096147352 12:49288231-49288253 CTGCCCTGTCTTTTGGCTTCTGG + Intergenic
1098598909 12:72306089-72306111 TGGCCAAGTGTTTTTTCTGCTGG + Intronic
1106418989 13:29569919-29569941 CAGCCGTGTGCTTTGTTTGCTGG - Intronic
1106701427 13:32233160-32233182 GGACCCTCTGTTTTCTCTGCAGG + Intronic
1106918005 13:34536050-34536072 CAGCCCTGTGTTTGACCTGCAGG - Intergenic
1107967911 13:45614117-45614139 GGGCCCTCTTTTTTCTCTGCAGG + Intronic
1114864294 14:26569146-26569168 CTGCTCTGTGTTGTTTCTGCTGG - Intronic
1115499398 14:34035912-34035934 AGGCCCTTTGTTCTGTCTCCTGG - Intronic
1117241047 14:53833602-53833624 GGGCCCAGTGTTTTCTCTGTGGG - Intergenic
1118024124 14:61751368-61751390 CAGCCCTGGGCTTTGTCTTCTGG + Intergenic
1121410533 14:93745684-93745706 CAGCCCTGTGCTGGGTCTGCTGG + Intronic
1121495822 14:94390773-94390795 GGGCCCAGTCTTGTGTCTGCCGG - Intergenic
1124578517 15:30930521-30930543 CTGTCCTGTGTTTTGTGTTCAGG + Exonic
1127688268 15:61369729-61369751 CGGGGCTGTGTTTCTTCTGCAGG - Intergenic
1132535328 16:476359-476381 CGGCACTGGCTTTTGCCTGCAGG + Intronic
1132951910 16:2567623-2567645 TGGCCCTGTATTCTGTGTGCTGG + Intronic
1132962440 16:2632547-2632569 TGGCCCTGTATTCTGTGTGCTGG - Intergenic
1138270903 16:55695213-55695235 CAACCCTGTGTTTTGACTGCTGG - Intronic
1140054716 16:71515978-71516000 GGGACCAGTGGTTTGTCTGCAGG + Intronic
1142385414 16:89760821-89760843 CGGCCCTGTCTGTTATCTCCAGG + Intronic
1143390837 17:6558312-6558334 GGCCCCTGTGCTTTGTCTACTGG + Intergenic
1143853260 17:9828688-9828710 AAGCCCTGTGTTTTTTCTTCCGG + Intronic
1146150651 17:30467059-30467081 CTGCCCTGTCTTTTATTTGCGGG + Exonic
1151322026 17:73358204-73358226 CGCCTCTGTGTGCTGTCTGCAGG - Exonic
1152386777 17:79979513-79979535 CGTCCCTGTGTCATCTCTGCAGG + Intronic
1152408086 17:80108675-80108697 CGGTCCCGTGTTGTGGCTGCAGG + Intergenic
1155118408 18:22793348-22793370 AGGGCCTGTGTTTTGTTTGCTGG - Intergenic
1157724353 18:49952350-49952372 CGGCCCTGGGTTTCCTCTGCAGG + Intronic
1160493282 18:79355396-79355418 CTGCTCTGTATCTTGTCTGCTGG - Intronic
1162825213 19:13247114-13247136 AGGCCCTGTGTTTTGTGTTTTGG - Intronic
1167402022 19:49279256-49279278 AAGCCCTGTGTTTTGTGTGCTGG + Intergenic
926190883 2:10726748-10726770 CCTCCTGGTGTTTTGTCTGCTGG + Intronic
931463475 2:62467673-62467695 CGGCTCTGTTTTCTGGCTGCAGG + Intergenic
932587989 2:73044267-73044289 GGGCCCTCAGATTTGTCTGCAGG - Intronic
932906890 2:75763651-75763673 AGGCCCTGATTTCTGTCTGCTGG + Intergenic
936077706 2:109412217-109412239 GGAGACTGTGTTTTGTCTGCTGG - Intronic
936081142 2:109433506-109433528 CGGCCCTGTGTTGACACTGCAGG + Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
942594882 2:177583508-177583530 GGTCCTTGTGATTTGTCTGCAGG - Intergenic
944101776 2:196035633-196035655 GGTCCCTGTTTTTTCTCTGCTGG - Intronic
1170718357 20:18851798-18851820 TGGCTCTGTGTTCTGTCTGTTGG + Intergenic
1172186001 20:33031448-33031470 AGGCCCTGTGTTTAATCTGGGGG + Intergenic
1173526851 20:43739317-43739339 CGGCCCAGTGCTGTGTCTGGTGG - Intergenic
1174325110 20:49772678-49772700 CTGTCCTGTGTGTTGTCTGATGG + Intergenic
1176216004 20:63948071-63948093 CGGACCTGTGTCTTGTCTCATGG - Intronic
1182049378 22:27301244-27301266 CAGCCCTGGATTTTATCTGCTGG - Intergenic
1183286339 22:36966775-36966797 TGCCCCAGTGTTTTGTCTGCAGG + Intergenic
1183654162 22:39175465-39175487 CGGCCCTTTGGTTTGGCTACAGG - Intergenic
950803740 3:15578476-15578498 CTCCCCCGTGTTTTGTCTCCTGG + Intronic
953024433 3:39136733-39136755 CGGACCTGTGTGTTGGATGCAGG - Intronic
953536373 3:43779975-43779997 CAGCCCTGTCTTTTGTCAGCAGG + Intergenic
956209210 3:66786068-66786090 CCTCCCTCTGTTTTATCTGCTGG - Intergenic
962000480 3:131289991-131290013 AGGCCCTGTGTTTTAACTGCTGG - Intronic
963445290 3:145397533-145397555 ATGGCCTGTGTTTTCTCTGCAGG - Intergenic
966738949 3:183214128-183214150 CTGCCCTGTGTATTGTTTCCAGG + Intronic
968780096 4:2573860-2573882 CGGCTCTTTGTTTTATCTGGGGG + Intronic
969521096 4:7678155-7678177 CGCCCCTGTGCTGTGTCTCCAGG - Intronic
969521169 4:7678520-7678542 CGCCCCTGTGCTGTGTCTCCAGG - Intronic
971339825 4:25757790-25757812 ATGCCCTGGGCTTTGTCTGCAGG - Exonic
974466186 4:62259406-62259428 TGGCTCTGTGTTTTGTCTATGGG - Intergenic
976235696 4:82894270-82894292 CTGCTTTGTGTTTTGTCTTCAGG + Intronic
985530997 5:433831-433853 GGGCCCCGTCTTTTCTCTGCAGG + Exonic
985846186 5:2350921-2350943 CTGCTTTGTGCTTTGTCTGCAGG + Intergenic
985928547 5:3036261-3036283 CGGCGCTGTGTTGTGGATGCGGG + Intergenic
986023048 5:3822676-3822698 CGGCGCTGTGTGTGGTTTGCAGG + Intergenic
988811734 5:34791940-34791962 CTGCCCTGTGCTTTGGCTCCTGG - Intronic
988835859 5:35031740-35031762 CAGCCTTGTGTTTTGTTTGACGG + Intronic
990677805 5:58207874-58207896 CTGCCCTGTGTTTTATCTTGAGG + Intergenic
991633745 5:68682419-68682441 AGGCCCTCTGTTCTGTCTCCGGG - Intergenic
992189718 5:74279982-74280004 GGGCCCTGTATTTTGTCTTGAGG + Intergenic
994478591 5:100303005-100303027 CAGCTCTGTGTTGTGTGTGCTGG - Intergenic
994945605 5:106384970-106384992 AGGCCCTGAGATTTTTCTGCGGG + Intergenic
995029872 5:107468189-107468211 CTGCCCTTTGTTTTGTCAGAAGG + Intronic
1003661865 6:8069831-8069853 CTGCTCTGTGTCTTGTATGCTGG - Intronic
1004174557 6:13328484-13328506 CGGCGCTGAGTTTTGTCTCCCGG - Intronic
1004864527 6:19838870-19838892 CGTCCCCGTGTTTTTTCTGGTGG + Intronic
1006390536 6:33755586-33755608 GGGTCCTGTGTTTTGTGTGGTGG + Intergenic
1006816098 6:36851089-36851111 CGGCCTTCTTTTTTGTCTACGGG - Intergenic
1010524602 6:76885280-76885302 CAGCCCTGTGTTGTTTCTGCTGG - Intergenic
1013078387 6:106790924-106790946 CGGCCCTGTCTTTTGGTTCCAGG - Intergenic
1016305612 6:142680563-142680585 TGTCGCTGTGTTTTGTCTCCAGG - Intergenic
1016920414 6:149287614-149287636 CGGCCCTGTGTTTTGTCTGCTGG - Intronic
1023170359 7:37385376-37385398 CAGCCCTGTGCTTGGCCTGCTGG - Intronic
1024311507 7:47973872-47973894 CAGCCCTGTCTTTTCTCTCCTGG + Intronic
1031752914 7:125599920-125599942 AGTTCCTGTGTTTTGTCTTCAGG - Intergenic
1035632278 8:1117206-1117228 CGGCACTGTGCTTTGTCCACAGG - Intergenic
1037588499 8:20294537-20294559 CTGCAGTGTGGTTTGTCTGCTGG + Intronic
1039961397 8:42250612-42250634 CGGCCCTGTCTTTGGCCTTCTGG - Intergenic
1041566541 8:59285067-59285089 CAGCCCTCTGTTTTCTCTGAGGG + Intergenic
1051372842 9:16372984-16373006 CCGCCCTCTGTCTTCTCTGCTGG - Intergenic
1056551859 9:87659236-87659258 CAGCTCTGTGCTTTCTCTGCAGG + Intronic
1056667290 9:88590798-88590820 CTGCACTGAGTTTTCTCTGCTGG + Intergenic
1057759946 9:97863847-97863869 CGTGCCTGTGTGTAGTCTGCAGG - Intergenic
1062320304 9:135987671-135987693 CTGCCCAGTCTTATGTCTGCAGG + Intergenic
1062463517 9:136671569-136671591 AGGCTCTGTGTATTGTCTGGGGG - Intronic
1185880694 X:3737831-3737853 CTTCTTTGTGTTTTGTCTGCTGG - Intergenic
1186935871 X:14449757-14449779 GGGCCCACAGTTTTGTCTGCTGG - Intergenic