ID: 1016932744

View in Genome Browser
Species Human (GRCh38)
Location 6:149426345-149426367
Sequence GAGCTTACAGCAAGCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016932744_1016932753 30 Left 1016932744 6:149426345-149426367 CCCACTGAGCTTGCTGTAAGCTC No data
Right 1016932753 6:149426398-149426420 TTCAGCACCATGAGGTTGGCTGG No data
1016932744_1016932750 22 Left 1016932744 6:149426345-149426367 CCCACTGAGCTTGCTGTAAGCTC No data
Right 1016932750 6:149426390-149426412 CCTGCACCTTCAGCACCATGAGG No data
1016932744_1016932751 26 Left 1016932744 6:149426345-149426367 CCCACTGAGCTTGCTGTAAGCTC No data
Right 1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016932744 Original CRISPR GAGCTTACAGCAAGCTCAGT GGG (reversed) Intergenic
No off target data available for this crispr