ID: 1016932745

View in Genome Browser
Species Human (GRCh38)
Location 6:149426346-149426368
Sequence AGAGCTTACAGCAAGCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016932745_1016932753 29 Left 1016932745 6:149426346-149426368 CCACTGAGCTTGCTGTAAGCTCT No data
Right 1016932753 6:149426398-149426420 TTCAGCACCATGAGGTTGGCTGG No data
1016932745_1016932751 25 Left 1016932745 6:149426346-149426368 CCACTGAGCTTGCTGTAAGCTCT No data
Right 1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG No data
1016932745_1016932754 30 Left 1016932745 6:149426346-149426368 CCACTGAGCTTGCTGTAAGCTCT No data
Right 1016932754 6:149426399-149426421 TCAGCACCATGAGGTTGGCTGGG No data
1016932745_1016932750 21 Left 1016932745 6:149426346-149426368 CCACTGAGCTTGCTGTAAGCTCT No data
Right 1016932750 6:149426390-149426412 CCTGCACCTTCAGCACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016932745 Original CRISPR AGAGCTTACAGCAAGCTCAG TGG (reversed) Intergenic