ID: 1016932746

View in Genome Browser
Species Human (GRCh38)
Location 6:149426370-149426392
Sequence AGGTGGTAGAAAGAGATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016932746_1016932757 28 Left 1016932746 6:149426370-149426392 CCCAGCATCTCTTTCTACCACCT No data
Right 1016932757 6:149426421-149426443 GCCTTACAGTCCAAGCAGCAGGG No data
1016932746_1016932750 -3 Left 1016932746 6:149426370-149426392 CCCAGCATCTCTTTCTACCACCT No data
Right 1016932750 6:149426390-149426412 CCTGCACCTTCAGCACCATGAGG No data
1016932746_1016932756 27 Left 1016932746 6:149426370-149426392 CCCAGCATCTCTTTCTACCACCT No data
Right 1016932756 6:149426420-149426442 GGCCTTACAGTCCAAGCAGCAGG No data
1016932746_1016932754 6 Left 1016932746 6:149426370-149426392 CCCAGCATCTCTTTCTACCACCT No data
Right 1016932754 6:149426399-149426421 TCAGCACCATGAGGTTGGCTGGG No data
1016932746_1016932753 5 Left 1016932746 6:149426370-149426392 CCCAGCATCTCTTTCTACCACCT No data
Right 1016932753 6:149426398-149426420 TTCAGCACCATGAGGTTGGCTGG No data
1016932746_1016932751 1 Left 1016932746 6:149426370-149426392 CCCAGCATCTCTTTCTACCACCT No data
Right 1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016932746 Original CRISPR AGGTGGTAGAAAGAGATGCT GGG (reversed) Intergenic
No off target data available for this crispr