ID: 1016932751

View in Genome Browser
Species Human (GRCh38)
Location 6:149426394-149426416
Sequence CACCTTCAGCACCATGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016932746_1016932751 1 Left 1016932746 6:149426370-149426392 CCCAGCATCTCTTTCTACCACCT No data
Right 1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG No data
1016932747_1016932751 0 Left 1016932747 6:149426371-149426393 CCAGCATCTCTTTCTACCACCTG No data
Right 1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG No data
1016932744_1016932751 26 Left 1016932744 6:149426345-149426367 CCCACTGAGCTTGCTGTAAGCTC No data
Right 1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG No data
1016932745_1016932751 25 Left 1016932745 6:149426346-149426368 CCACTGAGCTTGCTGTAAGCTCT No data
Right 1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016932751 Original CRISPR CACCTTCAGCACCATGAGGT TGG Intergenic
No off target data available for this crispr