ID: 1016932757

View in Genome Browser
Species Human (GRCh38)
Location 6:149426421-149426443
Sequence GCCTTACAGTCCAAGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016932746_1016932757 28 Left 1016932746 6:149426370-149426392 CCCAGCATCTCTTTCTACCACCT No data
Right 1016932757 6:149426421-149426443 GCCTTACAGTCCAAGCAGCAGGG No data
1016932747_1016932757 27 Left 1016932747 6:149426371-149426393 CCAGCATCTCTTTCTACCACCTG No data
Right 1016932757 6:149426421-149426443 GCCTTACAGTCCAAGCAGCAGGG No data
1016932755_1016932757 -7 Left 1016932755 6:149426405-149426427 CCATGAGGTTGGCTGGGCCTTAC No data
Right 1016932757 6:149426421-149426443 GCCTTACAGTCCAAGCAGCAGGG No data
1016932749_1016932757 8 Left 1016932749 6:149426390-149426412 CCTGCACCTTCAGCACCATGAGG No data
Right 1016932757 6:149426421-149426443 GCCTTACAGTCCAAGCAGCAGGG No data
1016932752_1016932757 2 Left 1016932752 6:149426396-149426418 CCTTCAGCACCATGAGGTTGGCT No data
Right 1016932757 6:149426421-149426443 GCCTTACAGTCCAAGCAGCAGGG No data
1016932748_1016932757 11 Left 1016932748 6:149426387-149426409 CCACCTGCACCTTCAGCACCATG No data
Right 1016932757 6:149426421-149426443 GCCTTACAGTCCAAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016932757 Original CRISPR GCCTTACAGTCCAAGCAGCA GGG Intergenic
No off target data available for this crispr