ID: 1016935356

View in Genome Browser
Species Human (GRCh38)
Location 6:149445653-149445675
Sequence CTGGATCTCAGGCCCACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016935356_1016935362 18 Left 1016935356 6:149445653-149445675 CCAGAGGTGGGCCTGAGATCCAG No data
Right 1016935362 6:149445694-149445716 CTTCCTTATCCCACAGTGATTGG No data
1016935356_1016935365 25 Left 1016935356 6:149445653-149445675 CCAGAGGTGGGCCTGAGATCCAG No data
Right 1016935365 6:149445701-149445723 ATCCCACAGTGATTGGTCCAGGG No data
1016935356_1016935364 24 Left 1016935356 6:149445653-149445675 CCAGAGGTGGGCCTGAGATCCAG No data
Right 1016935364 6:149445700-149445722 TATCCCACAGTGATTGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016935356 Original CRISPR CTGGATCTCAGGCCCACCTC TGG (reversed) Intergenic
No off target data available for this crispr