ID: 1016935359

View in Genome Browser
Species Human (GRCh38)
Location 6:149445664-149445686
Sequence GTTGGTCCAGCCTGGATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016935359_1016935364 13 Left 1016935359 6:149445664-149445686 CCTGAGATCCAGGCTGGACCAAC No data
Right 1016935364 6:149445700-149445722 TATCCCACAGTGATTGGTCCAGG No data
1016935359_1016935365 14 Left 1016935359 6:149445664-149445686 CCTGAGATCCAGGCTGGACCAAC No data
Right 1016935365 6:149445701-149445723 ATCCCACAGTGATTGGTCCAGGG No data
1016935359_1016935362 7 Left 1016935359 6:149445664-149445686 CCTGAGATCCAGGCTGGACCAAC No data
Right 1016935362 6:149445694-149445716 CTTCCTTATCCCACAGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016935359 Original CRISPR GTTGGTCCAGCCTGGATCTC AGG (reversed) Intergenic
No off target data available for this crispr