ID: 1016935360

View in Genome Browser
Species Human (GRCh38)
Location 6:149445672-149445694
Sequence GTACTACAGTTGGTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016935360_1016935362 -1 Left 1016935360 6:149445672-149445694 CCAGGCTGGACCAACTGTAGTAC No data
Right 1016935362 6:149445694-149445716 CTTCCTTATCCCACAGTGATTGG No data
1016935360_1016935369 29 Left 1016935360 6:149445672-149445694 CCAGGCTGGACCAACTGTAGTAC No data
Right 1016935369 6:149445724-149445746 ATGTGCACGTGACCCAAGCCAGG No data
1016935360_1016935364 5 Left 1016935360 6:149445672-149445694 CCAGGCTGGACCAACTGTAGTAC No data
Right 1016935364 6:149445700-149445722 TATCCCACAGTGATTGGTCCAGG No data
1016935360_1016935365 6 Left 1016935360 6:149445672-149445694 CCAGGCTGGACCAACTGTAGTAC No data
Right 1016935365 6:149445701-149445723 ATCCCACAGTGATTGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016935360 Original CRISPR GTACTACAGTTGGTCCAGCC TGG (reversed) Intergenic
No off target data available for this crispr