ID: 1016935364

View in Genome Browser
Species Human (GRCh38)
Location 6:149445700-149445722
Sequence TATCCCACAGTGATTGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016935356_1016935364 24 Left 1016935356 6:149445653-149445675 CCAGAGGTGGGCCTGAGATCCAG No data
Right 1016935364 6:149445700-149445722 TATCCCACAGTGATTGGTCCAGG No data
1016935360_1016935364 5 Left 1016935360 6:149445672-149445694 CCAGGCTGGACCAACTGTAGTAC No data
Right 1016935364 6:149445700-149445722 TATCCCACAGTGATTGGTCCAGG No data
1016935361_1016935364 -5 Left 1016935361 6:149445682-149445704 CCAACTGTAGTACTTCCTTATCC No data
Right 1016935364 6:149445700-149445722 TATCCCACAGTGATTGGTCCAGG No data
1016935359_1016935364 13 Left 1016935359 6:149445664-149445686 CCTGAGATCCAGGCTGGACCAAC No data
Right 1016935364 6:149445700-149445722 TATCCCACAGTGATTGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016935364 Original CRISPR TATCCCACAGTGATTGGTCC AGG Intergenic
No off target data available for this crispr