ID: 1016935392

View in Genome Browser
Species Human (GRCh38)
Location 6:149445870-149445892
Sequence GAGAATAAACAGAAGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016935385_1016935392 24 Left 1016935385 6:149445823-149445845 CCGGCCACGAGAATGGCTCTCAT No data
Right 1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG No data
1016935386_1016935392 20 Left 1016935386 6:149445827-149445849 CCACGAGAATGGCTCTCATTGTG No data
Right 1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016935392 Original CRISPR GAGAATAAACAGAAGGAAAC AGG Intergenic
No off target data available for this crispr