ID: 1016935647

View in Genome Browser
Species Human (GRCh38)
Location 6:149447487-149447509
Sequence CATGAAGCCCACCAAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016935644_1016935647 12 Left 1016935644 6:149447452-149447474 CCAGGTTGACCAGGCTGGTCTCG 0: 27
1: 2651
2: 59205
3: 185029
4: 219309
Right 1016935647 6:149447487-149447509 CATGAAGCCCACCAAAGTGCTGG 0: 1
1: 0
2: 0
3: 19
4: 284
1016935645_1016935647 3 Left 1016935645 6:149447461-149447483 CCAGGCTGGTCTCGAACTCCTGA 0: 51840
1: 157012
2: 220107
3: 177064
4: 94849
Right 1016935647 6:149447487-149447509 CATGAAGCCCACCAAAGTGCTGG 0: 1
1: 0
2: 0
3: 19
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016935647 Original CRISPR CATGAAGCCCACCAAAGTGC TGG Intergenic
901499710 1:9644262-9644284 ACTCAAGCCCCCCAAAGTGCTGG - Intergenic
902349814 1:15846354-15846376 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
902956317 1:19926256-19926278 CAGTAATCCCATCAAAGTGCTGG - Intergenic
904604145 1:31689788-31689810 CAGGAAGTCCAACAAAGTTCTGG + Exonic
904889306 1:33766410-33766432 TATGATGCCCACCACATTGCAGG + Intronic
906230576 1:44159392-44159414 CATCATGGCCACCCAAGTGCTGG + Intergenic
906242110 1:44248404-44248426 GAGGAGGCCCAGCAAAGTGCTGG - Intronic
907722548 1:56985530-56985552 CTTCAAGCCTTCCAAAGTGCTGG + Intergenic
908236536 1:62152403-62152425 CCTGACGCCTCCCAAAGTGCTGG - Intronic
908314368 1:62918265-62918287 CCTAAAGCCCATCAAATTGCAGG - Intergenic
910767338 1:90794850-90794872 CATTAGGGCCATCAAAGTGCTGG - Intergenic
910928976 1:92423645-92423667 CCTCAAGCCTCCCAAAGTGCTGG + Intergenic
912047676 1:105480639-105480661 CATGTAGCCCACAAAATAGCTGG - Intergenic
912136394 1:106664577-106664599 CATGAAAACCAACAAAGAGCAGG + Intergenic
914005336 1:143728149-143728171 CGTGAACCCTCCCAAAGTGCTGG - Intergenic
914097816 1:144559399-144559421 CGTGAACCCTCCCAAAGTGCTGG - Intergenic
914301174 1:146378209-146378231 CGTGAACCCTCCCAAAGTGCTGG + Intergenic
915536373 1:156538437-156538459 CCTTGAGCCCCCCAAAGTGCTGG + Intronic
915943138 1:160131572-160131594 CTTGGACCCCCCCAAAGTGCTGG - Intronic
916026477 1:160837738-160837760 GATGGAGCCTACCAAACTGCTGG - Intronic
916715482 1:167443447-167443469 CATGAAGGCCACCAAAGCTGGGG + Intronic
918341484 1:183571364-183571386 CATCCAGCCTCCCAAAGTGCTGG + Intronic
918696022 1:187547526-187547548 CAAGCAGCCTCCCAAAGTGCTGG - Intergenic
919864195 1:201767202-201767224 CATTCAGCCTCCCAAAGTGCTGG - Intronic
920001247 1:202800588-202800610 CCTGGAGCCTCCCAAAGTGCTGG + Intronic
920304818 1:205011828-205011850 CATTCAGCCTCCCAAAGTGCTGG - Intronic
920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG + Exonic
921064904 1:211615742-211615764 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
922526043 1:226304947-226304969 CATTTAGCCCCCCAAAGTGCTGG - Intronic
922951965 1:229566069-229566091 CATGCACCCTCCCAAAGTGCTGG + Intergenic
923354531 1:233140927-233140949 CATGAAGCCCACAGCAGAGCTGG - Intronic
923610067 1:235483487-235483509 CAAGTAGCCTCCCAAAGTGCTGG - Intronic
924712564 1:246542421-246542443 CACCTAGCCCCCCAAAGTGCTGG - Intronic
1063925569 10:10973815-10973837 CCTGCAGCCTCCCAAAGTGCTGG + Intergenic
1065839145 10:29686193-29686215 CAGGAAGACCACTAAAGTGTAGG - Intronic
1068713204 10:60156469-60156491 CTTGTAGCCCAGCACAGTGCTGG - Intronic
1068765177 10:60755416-60755438 CATAAAGCTCTCCCAAGTGCAGG + Intergenic
1069201881 10:65629390-65629412 CATGATGCCATCCAAAGTACTGG - Intergenic
1070028492 10:72654517-72654539 CCTTAAGCCTCCCAAAGTGCTGG + Intergenic
1070165320 10:73893326-73893348 CATGAGGACCAGCACAGTGCAGG + Intergenic
1071424443 10:85533989-85534011 CATGGTGCCCAACAAGGTGCTGG - Intergenic
1071461896 10:85905009-85905031 CAAGAAGCTCAACAAAGTGCAGG + Intronic
1072339055 10:94428539-94428561 CATTCAGCCTCCCAAAGTGCTGG + Intronic
1072599638 10:96913669-96913691 CCTGAGGCCTTCCAAAGTGCTGG - Intronic
1073018447 10:100420852-100420874 CCTGAGGCCTCCCAAAGTGCTGG - Intergenic
1073852623 10:107638613-107638635 CACGCAGCCTCCCAAAGTGCTGG - Intergenic
1074319048 10:112383941-112383963 CCTCAAGCCTCCCAAAGTGCTGG - Intronic
1074386564 10:113021042-113021064 CATAATGCCCGGCAAAGTGCTGG + Intronic
1075874306 10:125793792-125793814 CCTGAGGCCTCCCAAAGTGCTGG + Intronic
1077301197 11:1847749-1847771 CACGCAGCCTCCCAAAGTGCTGG - Intergenic
1078213715 11:9293350-9293372 GCTGAAGCCTCCCAAAGTGCTGG + Intronic
1079266716 11:18940395-18940417 CACGCAGCCTCCCAAAGTGCTGG - Intergenic
1080527082 11:33133610-33133632 CCTCAAGCCTTCCAAAGTGCTGG - Intronic
1082785083 11:57312468-57312490 AATGAAGCCCACCCAAGCCCTGG + Intronic
1083404220 11:62445602-62445624 CATTCAGCCTCCCAAAGTGCTGG - Intronic
1083905485 11:65666949-65666971 CATTCAGCCTTCCAAAGTGCTGG - Intergenic
1084977681 11:72811846-72811868 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
1085180574 11:74532215-74532237 TATTAATCCCACCAATGTGCCGG + Intronic
1085278401 11:75314465-75314487 CATGAGGCCCACAGAAGGGCAGG + Intronic
1086801378 11:91180827-91180849 CCTGAAGACCACCAGATTGCTGG + Intergenic
1086961082 11:92980664-92980686 CAGGAAGGCCACCATGGTGCAGG + Intronic
1087818230 11:102682482-102682504 CATGTGACCCACCAAAGTGCTGG + Intronic
1090268255 11:125368332-125368354 CATCAAGCCCACCAGAGCACTGG + Intronic
1092635635 12:10444429-10444451 AATGATGCCTCCCAAAGTGCTGG + Intronic
1096471720 12:51882099-51882121 AGTCAATCCCACCAAAGTGCTGG - Intergenic
1096994142 12:55828603-55828625 TATGGAGCCCACCACAGTGGTGG - Exonic
1100614655 12:96221694-96221716 CATGCATCCCAGCAAAGTGGGGG + Intronic
1102312572 12:111858152-111858174 CCTGCAGCCTCCCAAAGTGCTGG + Intronic
1102382976 12:112483441-112483463 CATGCAGCCTCCCAAGGTGCTGG + Intronic
1104102236 12:125623723-125623745 CAGGAAGCCCAACTAAGTGAAGG - Intronic
1104482600 12:129121344-129121366 CATTTAGCCTCCCAAAGTGCTGG + Intronic
1104989980 12:132619559-132619581 CGTGAAGCCCCCCGAGGTGCGGG + Exonic
1105556758 13:21454372-21454394 CATCAAGCCTCCCAAAGTGCTGG + Intronic
1107695732 13:42998066-42998088 CATGAAGCTCACAAAAGTGTTGG - Intergenic
1110202219 13:72865331-72865353 CATGAAGCCCGGCACAGTTCTGG + Intronic
1111291019 13:86169672-86169694 CACTACGCCCCCCAAAGTGCTGG + Intergenic
1112469185 13:99672522-99672544 GCTGAAGCCTCCCAAAGTGCTGG - Intronic
1115586106 14:34814724-34814746 CCTCAAGCCTCCCAAAGTGCTGG + Intronic
1116329148 14:43574394-43574416 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
1116559905 14:46364542-46364564 CATGAGGCCCAACAAATTGGGGG + Intergenic
1119341406 14:73882029-73882051 CATCCAGCCTCCCAAAGTGCTGG + Intronic
1119697622 14:76726272-76726294 CATGAGGCCTCCCAAAGTGCTGG + Intergenic
1121527270 14:94627835-94627857 CTTGAAGCCCACAAAGGGGCTGG - Intergenic
1122085481 14:99298970-99298992 CCTGATGCCTCCCAAAGTGCTGG - Intergenic
1124359792 15:29027850-29027872 CTTGAAGCCTCCCAAAGTGCTGG + Intronic
1126024291 15:44431209-44431231 CCTTAAGCCTCCCAAAGTGCTGG + Intronic
1126031081 15:44498355-44498377 AATGGAGCCTCCCAAAGTGCTGG - Intronic
1126733217 15:51705773-51705795 CATCCAGCCTACCAAAGTACTGG + Intronic
1127224376 15:56914823-56914845 CCTCAAGCCTCCCAAAGTGCTGG - Intronic
1127999760 15:64179709-64179731 CATGCAGCGCACCAAGGGGCTGG + Intronic
1129911408 15:79230146-79230168 CATCAAGCCTCCCAAAGTACTGG + Intergenic
1130145527 15:81271175-81271197 CAGGAGGCCTCCCAAAGTGCTGG - Intronic
1130709376 15:86264733-86264755 CTTGAAGTCCACCACAGAGCTGG - Exonic
1130795010 15:87198502-87198524 CATGACTCCAATCAAAGTGCAGG - Intergenic
1131478673 15:92763511-92763533 CATGGAGGCCACCACAGTCCTGG + Intronic
1132382741 15:101377975-101377997 CATGACTCCCACCTCAGTGCTGG - Intronic
1133032247 16:3017033-3017055 CCTCAAGCCTCCCAAAGTGCTGG + Intronic
1133111201 16:3549305-3549327 CTTGAAGCCCAAGAAACTGCAGG + Intronic
1133214311 16:4282187-4282209 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
1133330994 16:4973931-4973953 CCTGAGGCCTCCCAAAGTGCTGG + Intronic
1134751968 16:16632256-16632278 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
1134752283 16:16635542-16635564 CAGGAGGGCCACCAAAGGGCTGG + Intergenic
1135696310 16:24589934-24589956 AGTGAAGCCTCCCAAAGTGCTGG + Intergenic
1136598573 16:31268551-31268573 CAGGAGGCCTCCCAAAGTGCTGG + Intronic
1137569219 16:49554025-49554047 CATGAAGCCCAGCAAAGGAATGG - Intronic
1139742117 16:69044384-69044406 CAGGTAGCCCACCAAACTGCTGG - Intronic
1140168375 16:72578014-72578036 CCTGTAGCCTCCCAAAGTGCTGG - Intergenic
1142742158 17:1937522-1937544 CACGAAGCCCTCGAAGGTGCTGG + Exonic
1143125237 17:4637658-4637680 CCTGCAGCCTCCCAAAGTGCTGG + Intronic
1143246744 17:5492760-5492782 CATCAAGTCTCCCAAAGTGCTGG - Intergenic
1143458226 17:7081710-7081732 GTTGAAGCTCTCCAAAGTGCTGG - Intergenic
1143535902 17:7539310-7539332 CATGAATTCCACTAAAATGCAGG - Intergenic
1143605333 17:7981253-7981275 CCTGAAGCCTCCCAAAGTGCTGG - Intergenic
1143948648 17:10616071-10616093 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
1144789148 17:17847884-17847906 CATGAAGCCCACCTAGGAGCAGG + Intronic
1144942141 17:18949023-18949045 CAAGCAGCCTTCCAAAGTGCTGG - Intergenic
1146388251 17:32396962-32396984 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
1146588058 17:34100087-34100109 CCTGCAGACCACCAAAGAGCAGG + Intronic
1146708120 17:35017018-35017040 CATGAAACCCAGCATGGTGCTGG + Intronic
1147808558 17:43150037-43150059 CCTCAAGCCTCCCAAAGTGCTGG + Intergenic
1148033292 17:44638130-44638152 CAAGAAGCCTCTCAAAGTGCTGG + Intergenic
1149960465 17:61104173-61104195 CATCAAGCCCACCCAACTCCTGG - Intronic
1150187391 17:63198443-63198465 CCTCAAGCCTCCCAAAGTGCTGG + Intronic
1152027100 17:77817272-77817294 CAAGAGGCCTCCCAAAGTGCTGG + Intergenic
1152364518 17:79847668-79847690 CCTGCAGCCTCCCAAAGTGCTGG + Intergenic
1152668476 17:81586326-81586348 CGTGAGGCCACCCAAAGTGCTGG - Intronic
1152941827 17:83176883-83176905 GAGGAAGCCCACCAAGCTGCTGG - Intergenic
1154226216 18:12506864-12506886 AATGAAGCCTACCACAGTGGTGG - Intronic
1155093914 18:22537520-22537542 CATGAAGGCCAGCAGAGTGAAGG - Intergenic
1155145578 18:23080713-23080735 CCTTGAGCCCACCAAAGTACTGG + Intergenic
1155434954 18:25802549-25802571 CATTTAGCCTCCCAAAGTGCTGG + Intergenic
1156284423 18:35676847-35676869 CATGTTGCCTAACAAAGTGCTGG + Intronic
1156874462 18:41991272-41991294 CACGCAGCCAACCACAGTGCTGG - Intronic
1157789446 18:50518313-50518335 CATGTCGGCCTCCAAAGTGCTGG + Intergenic
1158001779 18:52627910-52627932 CAGGAAGGCCACCAAAATGTGGG - Intronic
1161177531 19:2855316-2855338 CCTCAAGCCTCCCAAAGTGCAGG - Exonic
1161213373 19:3079969-3079991 CACTCAGCCTACCAAAGTGCTGG - Intergenic
1161629683 19:5346698-5346720 CATGGAGCCCAGCACAGAGCAGG - Intergenic
1161804974 19:6437852-6437874 CAGGATGCCTCCCAAAGTGCTGG - Intronic
1162569452 19:11462706-11462728 CCTCAAGCCTCCCAAAGTGCTGG - Intronic
1163144870 19:15373449-15373471 CCTGCATCCCACCTAAGTGCTGG + Intronic
1163353323 19:16793473-16793495 CATTCAGCCTTCCAAAGTGCTGG + Intronic
1165456887 19:35917222-35917244 GATTCAGCCCCCCAAAGTGCTGG - Intergenic
1166194268 19:41195796-41195818 CATTCAGCCTTCCAAAGTGCTGG - Intronic
1166335841 19:42106659-42106681 CATCTAGCCTCCCAAAGTGCTGG - Intronic
1166529976 19:43536414-43536436 CCTCAAGCTAACCAAAGTGCTGG - Intergenic
1167043335 19:47035853-47035875 CATGAAGCGCACCTGCGTGCAGG + Intronic
1168187023 19:54706714-54706736 CCTGTGGCCCCCCAAAGTGCTGG + Intergenic
925400091 2:3566434-3566456 CCTGAGGCCTCCCAAAGTGCTGG + Intergenic
926387344 2:12349783-12349805 CATGAAATCCAGCACAGTGCTGG - Intergenic
927048565 2:19304341-19304363 CATTCAGCCTCCCAAAGTGCTGG + Intergenic
927101877 2:19794053-19794075 CAAGCAGCCCACCAAGGTGTTGG + Intergenic
927157711 2:20231167-20231189 CAGGAAACCCAGCAAAGAGCAGG + Intergenic
929404506 2:41626098-41626120 CTTCAAGCCTCCCAAAGTGCTGG - Intergenic
929674964 2:43917296-43917318 GCTGAAGCCTCCCAAAGTGCTGG + Intronic
930380093 2:50617135-50617157 TAAAAAGCCCTCCAAAGTGCTGG + Intronic
930633579 2:53781156-53781178 CCTCAAGCCTCCCAAAGTGCTGG - Intronic
934654046 2:96108173-96108195 TAGGAGGCCCACCAAATTGCTGG - Intergenic
937345121 2:121120720-121120742 CTTGCAGCCCCCCAAGGTGCGGG - Intergenic
937375573 2:121333637-121333659 CATGACGCTCAACAAAGTTCTGG - Intergenic
938452899 2:131439105-131439127 CATGAGGTCTCCCAAAGTGCTGG + Intergenic
941941168 2:171039587-171039609 CATGAAGGCCAGCAAATTCCAGG - Intronic
942646146 2:178112831-178112853 CACCAAGCCCATCAAGGTGCGGG + Exonic
945341174 2:208656887-208656909 CATGAAGCTCTCCTAATTGCAGG + Intronic
945736286 2:213604429-213604451 CTTGAAGCCCATCAAATTCCTGG + Intronic
946358844 2:219206883-219206905 CAGGGAGCCCGCCAGAGTGCGGG + Exonic
946670517 2:222098909-222098931 GCTGTAGCCCACCAAAGTTCAGG - Intergenic
948737708 2:240020221-240020243 CATGAAGCCAACCCTAGTGGCGG + Intronic
1170964925 20:21059670-21059692 CATTCAGCCTCCCAAAGTGCTGG + Intergenic
1171126405 20:22605716-22605738 CATGAAGGGCACCAAACTGTGGG - Intergenic
1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG + Intergenic
1172549671 20:35789164-35789186 CACTAAGCCTCCCAAAGTGCTGG - Intronic
1172807289 20:37621498-37621520 CCTTCAGCCCCCCAAAGTGCTGG + Intergenic
1173731598 20:45332824-45332846 CCTCAAGCCTCCCAAAGTGCTGG + Intronic
1174567082 20:51472868-51472890 CAAGAGATCCACCAAAGTGCTGG + Intronic
1176377275 21:6092838-6092860 CAGGAAGGCCACCAAGGAGCAGG - Intergenic
1178690212 21:34744172-34744194 CCTGAAGCCAACCAAAGTCTGGG + Intergenic
1179746200 21:43445406-43445428 CAGGAAGGCCACCAAGGAGCAGG + Intergenic
1180736671 22:18022820-18022842 CATGAAGTCCACAAATGTACAGG + Intronic
1181237327 22:21455626-21455648 CAGGAAGCCCCCCACAGAGCAGG + Intergenic
1182083260 22:27543809-27543831 CATGAAGCCAGCCAAGGTGCTGG - Intergenic
1182393594 22:30019657-30019679 AGGGAAGCCCACCAGAGTGCCGG + Exonic
1183916863 22:41127936-41127958 CATTTGGCCTACCAAAGTGCTGG - Intronic
1184449494 22:44574617-44574639 CAGGAAGCCCACCAATATGACGG - Intergenic
1185322956 22:50210321-50210343 CCTGGGGCCCAGCAAAGTGCAGG + Intronic
949684558 3:6553370-6553392 CATGTAGCCCGCAAAAGAGCTGG - Intergenic
950403626 3:12790249-12790271 CATCTAGCCTCCCAAAGTGCTGG + Intergenic
950771030 3:15311314-15311336 CCTGCAGCCTCCCAAAGTGCTGG - Intronic
950899869 3:16487863-16487885 GATGAAACCCATCAAAGGGCAGG + Intronic
952372811 3:32739670-32739692 TCTGCAGCCCACCAATGTGCTGG - Intronic
954066657 3:48112029-48112051 GCTGAAGCCTCCCAAAGTGCTGG - Intergenic
954344719 3:49987197-49987219 CAAGTAGCCTCCCAAAGTGCTGG + Intronic
954476979 3:50756147-50756169 CATGTGGCCCTCCCAAGTGCTGG - Intronic
960114839 3:113883893-113883915 CCTCAAGTCCCCCAAAGTGCTGG - Intronic
960240334 3:115333413-115333435 CATGGAGCCTAGCAATGTGCTGG - Intergenic
960719979 3:120616312-120616334 CATGTAGCCCACGAAAAAGCTGG + Intergenic
961313907 3:126021297-126021319 CATGCAGCTCTCCCAAGTGCTGG - Intronic
962443656 3:135446286-135446308 CATGCAGCCTAACAAAATGCAGG + Intergenic
962784233 3:138751718-138751740 CCTTAAGCCTTCCAAAGTGCTGG - Intronic
966158542 3:176944813-176944835 CACTAAGCCTCCCAAAGTGCTGG - Intergenic
967337477 3:188360604-188360626 ATTGAAGCCTTCCAAAGTGCTGG + Intronic
968154045 3:196363676-196363698 CCTCAAGCCTCCCAAAGTGCAGG - Intronic
970061330 4:12037828-12037850 CCTGAGGCCTCCCAAAGTGCTGG + Intergenic
974623143 4:64385897-64385919 CAAGAAGCCCAACCAAGTGTGGG - Intronic
978734059 4:112065227-112065249 CATCCAGCCTCCCAAAGTGCTGG - Intergenic
981978065 4:150755795-150755817 CATTCAGCCTCCCAAAGTGCTGG - Intronic
982545027 4:156723872-156723894 CATGACGCCCACTACAGTGGGGG + Intergenic
982857360 4:160400992-160401014 CATGAAACACACTAAAGTGGGGG - Intergenic
986605984 5:9523369-9523391 CATGAATCCCATAAAAATGCAGG + Intronic
987081331 5:14427710-14427732 CATGACCCCCACCAAAGAACTGG - Intronic
987389937 5:17366407-17366429 CACTAAGCCTCCCAAAGTGCTGG - Intergenic
987488024 5:18544526-18544548 CATGCTGCCCTCCCAAGTGCCGG + Intergenic
987613916 5:20247515-20247537 CATTTCGCCCTCCAAAGTGCTGG - Intronic
988592765 5:32563390-32563412 CATCCAGCCTCCCAAAGTGCTGG - Intronic
989042605 5:37244785-37244807 CCTTAAGCCTCCCAAAGTGCTGG - Intronic
989417903 5:41201983-41202005 CATGAAGCCCTTCTAAGTGTGGG + Intronic
989814344 5:45718245-45718267 CAAGCAGCCTCCCAAAGTGCTGG + Intergenic
991621332 5:68548515-68548537 CCTGAAGCCTAGCAAAGTGACGG + Intergenic
992265964 5:75018554-75018576 CGTGATCCCCCCCAAAGTGCTGG + Intergenic
993395181 5:87377585-87377607 CCTCAAGCCTCCCAAAGTGCCGG + Intronic
994561380 5:101378077-101378099 AATAAAGCCAACCATAGTGCAGG + Intergenic
995091409 5:108182731-108182753 CATGAAGCCTAACAAAGGGAAGG + Intronic
995192267 5:109330405-109330427 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
996144062 5:119951778-119951800 CAAGATGCATACCAAAGTGCAGG - Intergenic
996283786 5:121764822-121764844 GATGAAGCCCCCCAAAGTCAGGG - Intergenic
997179549 5:131814089-131814111 GATGATGCCCACCAAATTGAGGG + Intronic
997535440 5:134616980-134617002 CATCCAGCCTCCCAAAGTGCTGG - Intronic
997988441 5:138523815-138523837 CCTCAAGCCTCCCAAAGTGCTGG - Intronic
998000545 5:138621681-138621703 CCTTAAGCCTCCCAAAGTGCTGG - Intronic
998649892 5:144106762-144106784 CAAGAAGCCCACCATAGCTCAGG - Intergenic
1000590550 5:163152587-163152609 CGTGAGGCCTCCCAAAGTGCTGG - Intergenic
1001394727 5:171409348-171409370 CATGTTGCCTCCCAAAGTGCTGG - Intronic
1002079151 5:176727419-176727441 GACAAAGCCCACCAAAGGGCAGG - Intergenic
1002678825 5:180943377-180943399 CATCCAGCCTCCCAAAGTGCTGG + Intronic
1004202764 6:13564867-13564889 CATTCAGCCTCCCAAAGTGCTGG + Intergenic
1006068448 6:31479218-31479240 CAGGAAGGCCAAGAAAGTGCAGG - Intergenic
1007528554 6:42519670-42519692 CATCAAGCCTCCCAAAGTGCTGG + Intergenic
1008116748 6:47559501-47559523 GTTGAAGCCTCCCAAAGTGCTGG + Intronic
1010222329 6:73458727-73458749 CCTAAAGCCTCCCAAAGTGCTGG - Intergenic
1011690055 6:89858886-89858908 CCTCAAGCCTCCCAAAGTGCTGG + Intronic
1011693250 6:89888486-89888508 CTTGAGGCCTCCCAAAGTGCTGG + Intergenic
1012092498 6:94917536-94917558 CTTGAGGCCTCCCAAAGTGCTGG + Intergenic
1013039725 6:106421562-106421584 CATGAGGCCCTCCAAAGGGGAGG + Intergenic
1013114734 6:107094119-107094141 CCTGAAGCCTTCGAAAGTGCCGG - Intronic
1014723792 6:124951374-124951396 CATGAGGCCCAAAAAAGTGCAGG + Intergenic
1016935647 6:149447487-149447509 CATGAAGCCCACCAAAGTGCTGG + Intergenic
1017637008 6:156453761-156453783 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
1017744314 6:157433156-157433178 CATGAAACCGAGCACAGTGCTGG + Intronic
1018143928 6:160865402-160865424 CCTGAATCCCACCACAGTGTTGG + Intergenic
1019859074 7:3640108-3640130 CATCCAGCCTTCCAAAGTGCTGG + Intronic
1020189827 7:5986843-5986865 CATGAAGCACAGCAAAGTGAAGG - Exonic
1020192948 7:6014507-6014529 CCTCAAGCCTCCCAAAGTGCTGG + Intronic
1020293094 7:6737830-6737852 CATGAAGCACAGCAAAGTGAAGG + Intergenic
1021504378 7:21365324-21365346 CCTTAAGCCTCCCAAAGTGCTGG - Intergenic
1021536028 7:21705635-21705657 CATGAAGCCCACCATAATTTTGG + Intronic
1022434088 7:30362662-30362684 CCTGAGGCCTCCCAAAGTGCTGG - Intronic
1022797548 7:33744187-33744209 CATCAAACCCACCAAGGTGATGG - Intergenic
1023021282 7:36014084-36014106 CATATAGCCCCCCAAAGTGCTGG - Intergenic
1023558982 7:41452689-41452711 GATTCAGCCCCCCAAAGTGCTGG - Intergenic
1025047587 7:55705386-55705408 AATGCAGCCTCCCAAAGTGCTGG - Intergenic
1025077078 7:55952482-55952504 CCTCAAGCCTCCCAAAGTGCTGG - Intronic
1025924252 7:65944027-65944049 ACTGAAGCCTCCCAAAGTGCTGG - Intronic
1026650287 7:72210415-72210437 AATGCAGCCTCCCAAAGTGCTGG - Intronic
1028696872 7:93723974-93723996 CAGGGAGCCCTCCAGAGTGCTGG - Intronic
1031017779 7:116594285-116594307 CCTTCAGCCTACCAAAGTGCTGG + Intergenic
1031083628 7:117281487-117281509 TTTGACCCCCACCAAAGTGCTGG + Intronic
1031860517 7:126974683-126974705 CATCTAGCCTCCCAAAGTGCTGG - Intronic
1034432380 7:151047648-151047670 AAAAAAGCCCACCAAAGTCCTGG + Intronic
1035758830 8:2054766-2054788 AGTGAATCCCACCAAATTGCAGG - Intronic
1035868815 8:3113966-3113988 CCCTAAGCCTACCAAAGTGCTGG - Intronic
1036432932 8:8706475-8706497 CATGGTGCCCACAAATGTGCTGG - Intergenic
1036726534 8:11225710-11225732 CATGAGGCCCACCCAGGTGAAGG - Intergenic
1037309259 8:17537299-17537321 CCTCAAGCCTCCCAAAGTGCTGG + Intronic
1038804493 8:30778036-30778058 CATGAAGCCCTTCTAAGTGTGGG + Intronic
1040097506 8:43460265-43460287 CATGATGTCCATCATAGTGCTGG - Intergenic
1044493631 8:92849997-92850019 CCTAAAGCCTCCCAAAGTGCTGG - Intergenic
1044911978 8:97069377-97069399 CTTGCAGCCTCCCAAAGTGCTGG - Intronic
1045216347 8:100152602-100152624 CCTGCAGCCTCCCAAAGTGCTGG - Intronic
1046316473 8:112509337-112509359 CCTCAAGCCTCCCAAAGTGCTGG + Intronic
1047899324 8:129402869-129402891 CTTCAAGCCTCCCAAAGTGCTGG - Intergenic
1048195346 8:132327834-132327856 CATGAAGCCCCCCATGGTGTGGG + Intronic
1048454536 8:134565975-134565997 GATGATGGCCAGCAAAGTGCAGG + Intronic
1051869953 9:21726377-21726399 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
1053320873 9:37097896-37097918 CCTCAAGCCTCCCAAAGTGCTGG - Intergenic
1055612363 9:78035909-78035931 TTTGAAGGCCACCAAAGTCCCGG + Intergenic
1058465892 9:105226980-105227002 CAGGAGGCCTTCCAAAGTGCTGG + Intergenic
1060693887 9:125689495-125689517 CCTTAAGCCTCCCAAAGTGCAGG - Intronic
1060826964 9:126693167-126693189 CATGAAGCCGGCCAAGGGGCAGG + Exonic
1061356715 9:130111104-130111126 CATGAGGCCTCCCAAAATGCTGG + Intronic
1186065186 X:5755947-5755969 CAAGCAGCCTCCCAAAGTGCTGG - Intergenic
1186518274 X:10183493-10183515 GATGAGGACCACAAAAGTGCTGG - Intronic
1187056860 X:15748797-15748819 CCTCAAGCCTCCCAAAGTGCTGG - Intronic
1187215473 X:17271691-17271713 ACTTAAGCCTACCAAAGTGCTGG + Intergenic
1189314805 X:40047497-40047519 AATTAAGCCTTCCAAAGTGCTGG - Intergenic
1189406610 X:40730886-40730908 CACCAAGCCTCCCAAAGTGCTGG - Intronic
1189697949 X:43685127-43685149 CTTGAAGCCTCCCAAAGTGCTGG + Intronic
1190410006 X:50127484-50127506 CATTCAGCCTCCCAAAGTGCTGG + Intergenic
1193578322 X:83231368-83231390 CATGAATGCCAGCAAAGTGGTGG + Intergenic
1195321988 X:103728010-103728032 CCTGAAGCCCTCCAGACTGCGGG + Intronic
1196266480 X:113653471-113653493 CATAAAGCCCACAAAAGTGTAGG - Intergenic
1196688744 X:118536047-118536069 CATCAAGCCTCCCAAAGTGCTGG - Intronic
1196811443 X:119632145-119632167 CTTTAAGCCTCCCAAAGTGCTGG + Intronic
1198219545 X:134586945-134586967 CCTTAAGCCTCCCAAAGTGCTGG + Intronic
1198650592 X:138859795-138859817 CATGAAGGTCATAAAAGTGCAGG + Intronic