ID: 1016941362

View in Genome Browser
Species Human (GRCh38)
Location 6:149485172-149485194
Sequence GAGACTTGCTGCCCTCACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016941362_1016941366 -8 Left 1016941362 6:149485172-149485194 CCTCCGTGAGGGCAGCAAGTCTC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1016941366 6:149485187-149485209 CAAGTCTCCGTGAGGACGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 47
1016941362_1016941368 -2 Left 1016941362 6:149485172-149485194 CCTCCGTGAGGGCAGCAAGTCTC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1016941368 6:149485193-149485215 TCCGTGAGGACGGCTGGGATTGG 0: 1
1: 0
2: 1
3: 7
4: 85
1016941362_1016941370 16 Left 1016941362 6:149485172-149485194 CCTCCGTGAGGGCAGCAAGTCTC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1016941370 6:149485211-149485233 ATTGGCTGCACAGCAAAGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 157
1016941362_1016941367 -7 Left 1016941362 6:149485172-149485194 CCTCCGTGAGGGCAGCAAGTCTC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1016941367 6:149485188-149485210 AAGTCTCCGTGAGGACGGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 66
1016941362_1016941371 21 Left 1016941362 6:149485172-149485194 CCTCCGTGAGGGCAGCAAGTCTC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1016941371 6:149485216-149485238 CTGCACAGCAAAGCCAGGAGAGG 0: 1
1: 0
2: 2
3: 43
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016941362 Original CRISPR GAGACTTGCTGCCCTCACGG AGG (reversed) Intergenic
900167754 1:1250642-1250664 GTGACTTGCTGCCCTCACCCTGG + Intergenic
904178108 1:28645620-28645642 GAGTCTTGCTCCCGTCACGCAGG - Intergenic
905695380 1:39969698-39969720 GACACTTGCTGTGCTCACTGTGG + Exonic
905852417 1:41283868-41283890 CAGACCTGCTTCCCTCAAGGTGG + Intergenic
906207589 1:43995471-43995493 GAACGTGGCTGCCCTCACGGTGG + Intronic
920032618 1:203046361-203046383 GAGAATTGCAGCCCTCACCAAGG + Intronic
920847083 1:209603300-209603322 GTGACTTGCTTCCTTCACAGAGG + Intronic
1071531115 10:86390921-86390943 GAGTCCTGCTGCCTTCACAGGGG - Intergenic
1074327803 10:112469931-112469953 GTGACTTGCTGCACTCCCTGTGG + Intronic
1075093897 10:119458698-119458720 GAGACTTGCGGGCCTCAGGGAGG - Intronic
1076915340 10:133420657-133420679 GAGGCTTGCTGCCATCAGAGAGG + Exonic
1077700333 11:4435476-4435498 GAGAATTGCTACCCTCATGTAGG - Intergenic
1079140401 11:17805417-17805439 CAGCCTTGCTGAGCTCACGGTGG + Intronic
1083071890 11:59993367-59993389 GAGACTTGCTGACTTCAGGTGGG - Intergenic
1083297310 11:61721972-61721994 GAGATCTGCTGGCCTCATGGGGG - Intronic
1084708362 11:70829174-70829196 GAGCCTTTTTCCCCTCACGGGGG + Intronic
1096822156 12:54244887-54244909 GAGGCTTTCTGCCATCACTGAGG - Intronic
1102629596 12:114266271-114266293 GAAAATTGCTGCCCTCGTGGGGG + Intergenic
1104329250 12:127828835-127828857 GAGGCATGCTCTCCTCACGGTGG - Intergenic
1110860916 13:80343245-80343267 GAGACTTGCTGGCCGCACACCGG - Intergenic
1113957168 13:114105119-114105141 GAGACTACCTGCCCTGACTGGGG - Intronic
1122741054 14:103871895-103871917 GCGCCTTCCTGCCCTCCCGGTGG + Intergenic
1122825628 14:104369096-104369118 GTGACCTGCTGCCCCCAGGGCGG + Intergenic
1128218351 15:65949915-65949937 TAGACTTCCTGCTCACACGGGGG - Intronic
1129376941 15:75139502-75139524 GAGCCTTGGTGCTCTCACTGGGG - Intergenic
1131828018 15:96335090-96335112 GAAAATTGCTGCCCTCAGGTTGG - Intronic
1132798878 16:1741702-1741724 GTGGCTGGCTGCCTTCACGGTGG + Intronic
1132912885 16:2324687-2324709 GAGACAAGCTGCCATCAAGGAGG + Intronic
1134680509 16:16121834-16121856 GAGCCGGGCTGCCCTCACAGGGG - Intronic
1138114246 16:54347845-54347867 GAGACTAGCTGCCCTCTCCCCGG - Intergenic
1139399869 16:66672947-66672969 GAGTCTTGCTCCCATCACAGTGG + Intronic
1143619134 17:8071288-8071310 GAGACCTGCTGCCCACAAAGGGG - Intergenic
1144080736 17:11761675-11761697 GAGACTTGCTGATCTCCCAGTGG - Intronic
1144783473 17:17819365-17819387 GAGACCTGCCGCCTTCACAGTGG + Exonic
1147469799 17:40648401-40648423 AGGGCTTCCTGCCCTCACGGCGG + Exonic
1147790889 17:43013814-43013836 GGGACTTGCTGCCCACCCAGTGG - Exonic
1151343230 17:73485228-73485250 GAGCCTTCCTGCCCTCAGGAGGG - Intronic
1151539796 17:74759077-74759099 GAGACTTCCTCCCCTCACATGGG - Intronic
1151848512 17:76674926-76674948 GAGACTAGCTCTCCTCATGGTGG - Exonic
1152309124 17:79538465-79538487 GAGGCTTCCTGCCCTGACTGTGG - Intergenic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1159806214 18:72961352-72961374 TAGACATTCTGCCCTCAAGGTGG - Intergenic
1161915386 19:7224501-7224523 GAGGCTCGCTGCCCCCATGGCGG - Intronic
1166386011 19:42381670-42381692 GAGATTTGCTGCCCTGAGAGAGG + Intergenic
1166434042 19:42752166-42752188 GTGACTTGCTGCCCACAAGTGGG + Intronic
1167717846 19:51155333-51155355 GGGAGCTGCTGCACTCACGGGGG + Intergenic
927940540 2:27100463-27100485 GAGTGTTGCTGTCCTCAGGGAGG + Exonic
934940940 2:98501551-98501573 GAACCTTGATGCCCTCACTGAGG + Intronic
937205406 2:120233454-120233476 GAGATTTGCTCCCATTACGGGGG + Intergenic
942146554 2:173032649-173032671 AAGACTTGATGCCCTCACTTAGG - Intronic
948576534 2:238955227-238955249 GAGTCCTTCTGTCCTCACGGAGG - Intergenic
949046809 2:241876274-241876296 GTGGCTTGCTGCCCACACAGGGG + Intergenic
1169253137 20:4075444-4075466 GAGACTTCCTGCCATCAAGAAGG + Intergenic
1172696013 20:36823378-36823400 CAGACCCGCAGCCCTCACGGTGG + Intronic
1173466906 20:43290509-43290531 GAACTTTGCTGCCCTCACTGTGG - Intergenic
1175561493 20:59933951-59933973 GAGACTCGCTGCCTTGACTGGGG + Intronic
1182218396 22:28738616-28738638 GAGTTTTGCTGCCCTCACTTTGG - Intronic
1182768493 22:32776071-32776093 GAGATCTGGTGCCCTCACAGAGG + Intronic
1183936573 22:41265791-41265813 GAGACTTTCTGCCCTCACCCTGG + Intronic
1184452247 22:44590297-44590319 GAGGCTGGCTGCCCTCATGAGGG - Intergenic
1184732879 22:46380638-46380660 GAGGCTCACTGCCCCCACGGGGG + Intronic
952970164 3:38645686-38645708 CAGACCTGCAGCCCTCACTGAGG + Intronic
958085307 3:88798378-88798400 GAGACTTGCTGGCTTCAGGTGGG - Intergenic
968693629 4:2009359-2009381 CAGACTTGCTGCTCGCGCGGTGG + Exonic
979100252 4:116603900-116603922 GAGACTTTCTGGCCTCAGGTGGG - Intergenic
979785651 4:124712713-124712735 GACAGTTACTGCCCTGACGGCGG - Exonic
984841363 4:184070603-184070625 GAGACTCGATGCCCTCCCTGTGG - Intergenic
984937762 4:184904228-184904250 GAGACTTACTGCCTTCCCAGAGG - Intergenic
985334094 4:188872989-188873011 CTGACTTGGTGCCATCACGGAGG + Intergenic
985899772 5:2779585-2779607 GAGAGTGGCTGCCCTCAGGCTGG + Intergenic
990169118 5:53028238-53028260 GAGAAATGCTGCCCTCTCAGGGG - Intronic
992487767 5:77211543-77211565 CAGCCTTCCTGCCCTCAAGGAGG - Intronic
998911293 5:146963239-146963261 GAGATTTGCTGTCTTCATGGAGG + Intronic
1002621444 5:180491466-180491488 GAGACTTGCTGCCACCAGGAGGG - Intergenic
1003240896 6:4344766-4344788 GAAAACTGCTGCCCCCACGGAGG - Intergenic
1007143153 6:39597454-39597476 GAGACATGCTGTGCTCACTGAGG + Intronic
1009519497 6:64663763-64663785 GAGGCTTGCTGCCATCTTGGGGG - Intronic
1014428597 6:121339906-121339928 GAGAACTGCTGGCTTCACGGAGG + Intergenic
1016941362 6:149485172-149485194 GAGACTTGCTGCCCTCACGGAGG - Intergenic
1019364125 7:622913-622935 TAGACATGCTGCCCTCGCTGGGG + Intronic
1019894241 7:3971400-3971422 GACAGTTTCTGCCCTCAGGGGGG - Intronic
1020613152 7:10426432-10426454 GAGACTTGCTGGCTTCAGGTGGG - Intergenic
1029305569 7:99617146-99617168 GAGACTTGCCGCCCTCAGCCGGG - Intronic
1030935722 7:115583581-115583603 GACTCTTGCTGCCCTCTCTGTGG - Intergenic
1039408822 8:37335008-37335030 CAGAGTTTCTGCCCTCAAGGAGG + Intergenic
1047390265 8:124444864-124444886 GAGACTTCCTTCCCTCACTAAGG - Intergenic
1050702374 9:8355111-8355133 AAGGCTTGGTGCCCTCACGGTGG + Intronic
1053014744 9:34655358-34655380 GTGACTTGCCACCCTCACTGTGG + Intronic
1053312893 9:37030472-37030494 GAGACTAGCAGCTCTCACCGCGG + Intronic
1056896430 9:90554917-90554939 GAGGCATTCTGCCCTCAAGGAGG + Intergenic
1060277110 9:122190831-122190853 GGGCATTGCTGCCCTCACTGTGG + Intronic
1061914713 9:133743741-133743763 GAGTCTTGCTCCCGTCACGCAGG + Intergenic
1062523973 9:136970864-136970886 GAGGCTTCCTGGCCTCCCGGAGG - Intronic
1062639447 9:137510803-137510825 GTGACTTTCCGCCCACACGGGGG - Intronic
1185497757 X:570656-570678 GAGGCTTGCTCCCATCACAGAGG + Intergenic
1187446272 X:19363995-19364017 GAGACATGCTGCTCTGCCGGTGG + Intronic
1190641276 X:52483812-52483834 CAGACTTGCTGCACTCTGGGCGG - Intergenic
1190646396 X:52529053-52529075 CAGACTTGCTGCACTCTGGGCGG + Intergenic
1193467753 X:81868715-81868737 GGGACTTTCTGCACTCTCGGGGG - Intergenic
1194380330 X:93182106-93182128 GAGACAACCTGCCCACACGGAGG + Intergenic
1194802161 X:98287399-98287421 CAGAATTCCTGCCCTCAAGGAGG + Intergenic
1198666033 X:139024433-139024455 GAGATTTGCTGGCCTCATGTTGG - Intronic