ID: 1016941610

View in Genome Browser
Species Human (GRCh38)
Location 6:149486929-149486951
Sequence ATTAAGTGGCTGAGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016941605_1016941610 -2 Left 1016941605 6:149486908-149486930 CCAACCTGCCCACGTTCACTCAT No data
Right 1016941610 6:149486929-149486951 ATTAAGTGGCTGAGTGAAGATGG No data
1016941606_1016941610 -6 Left 1016941606 6:149486912-149486934 CCTGCCCACGTTCACTCATTAAG No data
Right 1016941610 6:149486929-149486951 ATTAAGTGGCTGAGTGAAGATGG No data
1016941608_1016941610 -10 Left 1016941608 6:149486916-149486938 CCCACGTTCACTCATTAAGTGGC No data
Right 1016941610 6:149486929-149486951 ATTAAGTGGCTGAGTGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016941610 Original CRISPR ATTAAGTGGCTGAGTGAAGA TGG Intergenic
No off target data available for this crispr