ID: 1016944087

View in Genome Browser
Species Human (GRCh38)
Location 6:149512011-149512033
Sequence AAGAAGCAGAATGGTTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016944087 Original CRISPR AAGAAGCAGAATGGTTGCAC TGG (reversed) Intronic
900008414 1:81442-81464 AAGAAACAGAATGGTTGTATGGG - Intergenic
900036640 1:415524-415546 AAGAAACAGAATGGTTGTATGGG - Intergenic
900058269 1:651272-651294 AAGAAACAGAATGGTTGTATGGG - Intergenic
902074974 1:13777254-13777276 GAGAGGCAGGATGGTGGCACAGG - Intronic
903533988 1:24054370-24054392 AAGAAGCAACACTGTTGCACTGG + Intergenic
905097025 1:35481791-35481813 AAACAGCAGAATGGTTGCTTAGG - Intronic
905350209 1:37340375-37340397 GAAAACCAGAATGGTTGTACAGG - Intergenic
907193474 1:52667801-52667823 AAAAAGCAGAAAGGATGCAAAGG - Intronic
908149023 1:61280651-61280673 AAAAAGCAGACTAGTTGGACAGG - Intronic
909308481 1:74113834-74113856 AAAAAGCAGAATGCTGGCAAAGG + Intronic
909320127 1:74274934-74274956 AAAAAGCAGAATGGTCGTATGGG + Intronic
909790171 1:79666999-79667021 AAGAAACAGAAGGGTTGTTCTGG - Intergenic
912217899 1:107636656-107636678 GAAAAACAGAATGGTTGCATGGG + Intronic
913179558 1:116308399-116308421 AAGAAGCAGAATGTTTGGTTGGG - Intergenic
913218701 1:116642577-116642599 AAGAAGCAGATTGGTTCAACAGG + Intronic
914070330 1:144281060-144281082 AAGAAGCAGAATGGGAGGCCGGG + Intergenic
914108825 1:144685294-144685316 AAGAAGCAGAATGGGAGGCCGGG - Intergenic
915043647 1:152991699-152991721 AAGAATGAGAATGGGTGGACTGG - Intergenic
915568859 1:156732991-156733013 AAGAAGCTGAGTGATTTCACAGG + Exonic
917430193 1:174958807-174958829 AAGATGCTGAATGGTGGCATGGG - Intronic
917930937 1:179822206-179822228 GAGAAACAGAATGGTTGTATGGG + Intergenic
918213445 1:182372233-182372255 AAAAAGCTGAATGGGGGCACAGG - Intergenic
918321585 1:183370099-183370121 CAGAAGCAGAAGGGTGGCAAAGG + Intronic
919480538 1:198082928-198082950 AAGAACGAGAATGGGTGCAGTGG - Intergenic
919651755 1:200156391-200156413 AAAAACCAGAATGGTTGTATGGG - Intronic
920055487 1:203187765-203187787 AAGAGGCAGAATGGGTCCAAGGG + Intergenic
922047493 1:221960630-221960652 AAGAGGCAGAATGGTATTACTGG - Intergenic
922317429 1:224455188-224455210 AAAAAACAGAATGGTTGTATGGG + Intronic
924670150 1:246115611-246115633 AAAAAGCAGCATGGTTTCACTGG + Intronic
1064680357 10:17805894-17805916 GAGAAGCAGAATGGGTGTATGGG - Intergenic
1064974184 10:21096444-21096466 AAAAAACAGAATGTTTACACGGG + Intronic
1065182066 10:23136250-23136272 CAAAAGAAGAATGGGTGCACTGG + Intergenic
1066093222 10:32047060-32047082 GAAAAACAGAATGGTTGTACAGG + Intronic
1066244640 10:33570665-33570687 AAGAAGCAGAGTGGGTGACCAGG + Intergenic
1068768088 10:60787192-60787214 AAAAAACAGAATGGTTGTATGGG - Intronic
1069428398 10:68311066-68311088 AAAAAGCAAAATGGTTGTATGGG + Intronic
1070674209 10:78400856-78400878 GAAAAACAGAATGGTTGCATAGG + Intergenic
1072855816 10:98944922-98944944 AAGAGGCATAATGGTTTCCCCGG - Intronic
1075964210 10:126596717-126596739 GAGAAACAGAATGGTTGTATGGG + Intronic
1076052181 10:127344338-127344360 AAGAAGCACCATTGTTGCATGGG + Intronic
1076318688 10:129562970-129562992 GAGACGCAGAATGGTGGCACGGG - Intronic
1079332727 11:19547021-19547043 TAGAATCAGAGTGGGTGCACCGG + Intronic
1080619358 11:33974039-33974061 GAAAAACAGAATGGTTGCATGGG + Intergenic
1080809778 11:35691966-35691988 AAAAAGCAGAATAGTTGTATAGG + Intronic
1086428306 11:86709434-86709456 AAAAAACAGAATGGTTGTATGGG - Intergenic
1087564195 11:99833411-99833433 AAGAAACAGATTGGTTGTATGGG - Intronic
1088834503 11:113566627-113566649 CAGAAGCAGGATGGTAGCAGAGG + Intergenic
1088942662 11:114476349-114476371 AAGAAGAAGAAATGTTGCAATGG - Intergenic
1091833679 12:3569003-3569025 AGGGAACAGAATGGTTGCCCCGG + Intronic
1091941473 12:4487501-4487523 CAGAAGCAGAATGGAGGCAGTGG - Intergenic
1093204785 12:16234596-16234618 ATAAAGCACAATGGTTGCATAGG + Intronic
1093402168 12:18759803-18759825 GAAAAGCAGAATGGTTGTATGGG + Intergenic
1093600809 12:21020030-21020052 CAGAAGCAAAATGTTTCCACTGG + Intronic
1094568285 12:31619485-31619507 AAGAAGCAGGCTGGGTGCAGTGG - Intergenic
1094744220 12:33325869-33325891 AAGAGGCAGAAGAGTTGCAGGGG + Intergenic
1096407052 12:51351477-51351499 AATAAGCAGAGTTGTTACACAGG - Exonic
1097322277 12:58239383-58239405 GATTAGCAGAGTGGTTGCACTGG + Intergenic
1097984997 12:65773560-65773582 GAAAAACAGAATGGTTGCATGGG + Intergenic
1098769193 12:74531789-74531811 GAAAAGCAGAATGGTTGTATAGG - Intergenic
1099032046 12:77538545-77538567 CAGTAGCAAAATGGTTGCAATGG + Intergenic
1100516166 12:95329878-95329900 AAGCAGCAGCAGGGTTGGACAGG - Intergenic
1100939699 12:99712695-99712717 AAAAAGTACAATGGTGGCACAGG + Intronic
1102892393 12:116570285-116570307 AAAAAGCAGAATGGCTGTATGGG - Intergenic
1103270621 12:119670025-119670047 AGGAAGAAAAATGTTTGCACTGG - Intronic
1103557090 12:121773298-121773320 CAGAAGCAGAAAGGGTGCCCTGG - Intronic
1103808776 12:123596172-123596194 AAAAAACAGAATGGTTGCATGGG - Intronic
1104457238 12:128924989-128925011 AAGAAGCAGCATTGTTTCCCAGG - Intronic
1106662684 13:31817784-31817806 ACTATGCAGAATGGTTGCAGTGG + Intergenic
1107404224 13:40097944-40097966 ATGAGGCAGGATGCTTGCACAGG + Intergenic
1107758876 13:43654938-43654960 AAGAAACAGAGTGGTTGGAGTGG - Intronic
1109052066 13:57495816-57495838 AAGAAGCAAAATGTGAGCACAGG + Intergenic
1109827808 13:67745568-67745590 GAAAACCAGAATGGTTGTACGGG - Intergenic
1110747730 13:79075112-79075134 AAGAAACAGAAAGCTTGAACAGG + Intergenic
1112121318 13:96415144-96415166 AAGATTCAAAATGGTTGAACAGG - Intronic
1112157086 13:96830037-96830059 AAAAAACAGAATGGTTGTATGGG - Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1115325774 14:32136302-32136324 AGAAAGCAGATTGGTTGCAAGGG - Intronic
1115607234 14:35015739-35015761 AAGAGGCAGAATAGTTGCTACGG - Intronic
1115704679 14:35986922-35986944 AAGAAGTAGAATGCTTCCATAGG + Intergenic
1116727799 14:48584208-48584230 TAGAAACAGGATGGATGCACTGG + Intergenic
1117089483 14:52235809-52235831 AAAAAGCAGGATGCTTGCAAGGG + Intergenic
1117543536 14:56771423-56771445 AACAACCAGCATGGCTGCACTGG + Intergenic
1117820725 14:59645784-59645806 CAGGGGCAGAGTGGTTGCACTGG - Intronic
1119117009 14:72033205-72033227 AAAAAACAAAATGGTTGCATTGG + Intronic
1119744580 14:77034893-77034915 AAGAAAGAGAATGGTTTTACAGG - Intergenic
1120136574 14:80877630-80877652 AAAAGCCAGAATGGCTGCACAGG + Intronic
1121494329 14:94381550-94381572 AGTAAGCAGAATGTTTGCCCTGG - Intronic
1121967572 14:98324734-98324756 AAAAAGCAGAATGATTGTATAGG + Intergenic
1122011191 14:98750264-98750286 AACCAGCAGCATGGTTGCCCTGG - Intergenic
1123784063 15:23651088-23651110 AGGAAGCAGGAAGGTTTCACAGG - Intergenic
1123895517 15:24825785-24825807 GAAAAGCAGAATGGTTGTATGGG + Intronic
1125795313 15:42400107-42400129 GAAAAACAGAATGGTTGTACGGG + Intronic
1126696013 15:51326028-51326050 GAGAAACAGAATGGTTGTATGGG + Intronic
1126896881 15:53267540-53267562 GAAAAGCAGAATGGTTGTATGGG - Intergenic
1127787574 15:62369570-62369592 AAGAAACAGAATGGTTGTATGGG + Intergenic
1128592279 15:68910917-68910939 AACAAGCAGAATTGTTGCTAGGG - Intronic
1128829507 15:70754325-70754347 AAAAAACAGAATAGTTGTACGGG - Intronic
1130143297 15:81251144-81251166 AACAAGTAGAAAGGTTGCATGGG - Intronic
1130359880 15:83173238-83173260 AAGAAATAGAATGGTTGTAAGGG - Intronic
1130716968 15:86344196-86344218 AAAAAGCAGAATTGTACCACGGG + Intronic
1132445142 15:101910673-101910695 AAGAAACAGAATGGTTGTATGGG + Intergenic
1133560332 16:6944707-6944729 AAGGGGCAGAAAGGTTGCCCAGG - Intronic
1134309943 16:13066851-13066873 AATAAGTGGCATGGTTGCACTGG + Intronic
1134335369 16:13294515-13294537 ATGAAGCAGAATTGATGCACTGG - Intergenic
1134657573 16:15958768-15958790 TAGAGGCTGAATGGTTGAACGGG + Intronic
1135049941 16:19184759-19184781 AATAAGGAGAATGATTGCACAGG + Intronic
1136614931 16:31393008-31393030 AGGAAGCAGAATGGCTGCAGAGG - Intergenic
1139291430 16:65861787-65861809 GAAAAACAGAATGGTTGCATGGG - Intergenic
1140279637 16:73543037-73543059 GGGAAGGAGAAGGGTTGCACAGG + Intergenic
1140339289 16:74141237-74141259 AAGTAGAAGAATGGTTGCCAGGG + Intergenic
1140577137 16:76183916-76183938 AAGAAGCAGAATGTTTGGTTTGG + Intergenic
1143432743 17:6898974-6898996 AAGAAGCAGATTGTTTGCAGAGG - Intronic
1144149494 17:12429705-12429727 AAGAAAGAGAATGGATCCACGGG - Intergenic
1145892509 17:28427042-28427064 AAGAAGAAGGCTGGTTGCAGTGG + Intergenic
1145988754 17:29065457-29065479 AAGAAGCTGATTGTTTGCATTGG - Intergenic
1146159285 17:30551167-30551189 AAGCAGCAGATGGGGTGCACTGG + Intergenic
1148317729 17:46718129-46718151 GAGAAGCCAAATGGCTGCACTGG + Intronic
1149186352 17:54002109-54002131 AACAAGCAGATTGCTTCCACTGG + Intergenic
1151372959 17:73660785-73660807 GAAAAACAGAATGGTTGCATGGG - Intergenic
1153697297 18:7656995-7657017 AAGAAGCAGAAAGTTTCCAAAGG - Intronic
1155207211 18:23570537-23570559 AAGAAGCAGAATTTCTTCACTGG + Intronic
1156191103 18:34721403-34721425 GAGAATCAGAATGATTGCTCTGG - Intronic
1156663684 18:39379763-39379785 GAAAAACAGAATGGTTGTACAGG - Intergenic
1157898946 18:51495042-51495064 GAGAAGCAAAATGGGTGCAAAGG + Intergenic
1158912642 18:62081083-62081105 GAGAAGCAGAATCATTTCACTGG + Intronic
1159314601 18:66755555-66755577 AAAAGGCAGAATGGTTGTATTGG - Intergenic
1160004028 18:75054968-75054990 CAGGAGCAGAAGGCTTGCACTGG + Intronic
1160335156 18:78031906-78031928 CATAAGCACAATGGCTGCACGGG + Intergenic
1160640169 19:123034-123056 AAGAAACAGAATGGTTGTATGGG - Intergenic
1162458201 19:10798456-10798478 AACAAGCAGAGTGGTCGCATTGG - Intronic
1164561603 19:29296057-29296079 AACATGCAGAAGGGTTGCATCGG - Intergenic
1164712742 19:30369387-30369409 GAAAACCAGAATGGTAGCACAGG + Intronic
1165102480 19:33447093-33447115 CAGAAGCAGCACGGTGGCACAGG - Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1168628269 19:57935801-57935823 TAGACACAGAATGCTTGCACTGG + Intergenic
925052310 2:825899-825921 ATGAAGTAGAATAGTGGCACTGG + Intergenic
926611723 2:14954312-14954334 AAGATGCAGGATGCCTGCACGGG + Intergenic
928048257 2:27961356-27961378 GAAAAGCAGAATGGTTGCATGGG - Intronic
928853103 2:35772432-35772454 AAGATGCAGGCTGGTTGCAGTGG + Intergenic
930229116 2:48826074-48826096 AAAAAACAGAATGGTTGTATGGG + Intergenic
930304941 2:49665872-49665894 CAGAAGCAGAGTGGCTGTACTGG + Intergenic
932008613 2:67953220-67953242 GAAAAACAGAATGGTTGTACAGG + Intergenic
932277515 2:70462596-70462618 AATAAGCAGAATGGCAACACCGG - Intronic
932995133 2:76842647-76842669 GAAAAACAGAATGGTTGCATGGG + Intronic
933688348 2:85160562-85160584 AAGAAGCAGGCTGGGTGCAGTGG + Intronic
933749350 2:85593175-85593197 GAGAAGCCAAATGGCTGCACTGG + Exonic
938199002 2:129357581-129357603 CAGAAGCAGAAAGGCTGCAGGGG - Intergenic
939350406 2:141029690-141029712 GAGTATCAGCATGGTTGCACTGG - Intronic
939488976 2:142854091-142854113 GAGAAGCAGCCTGGTTGCCCCGG - Intergenic
942184861 2:173415412-173415434 CAGAAGCAGAATGTTTGAAATGG + Intergenic
942719941 2:178939978-178940000 AAGAAGCAGAATTAATGCACTGG + Intronic
943572158 2:189586338-189586360 AAGAAGAAGAATATTTGCACAGG + Intergenic
944505078 2:200402605-200402627 AAGAAGCAGTAAGGATGCTCTGG - Intronic
945980406 2:216305600-216305622 AAGTAGCAGAATGGGTGGGCAGG + Intronic
947809491 2:232993883-232993905 AAGCAGATGAATGGTTGCCCAGG + Intronic
948652893 2:239459516-239459538 AGGAAGCAGCATGATTTCACAGG - Intergenic
1169521536 20:6378924-6378946 TAGAAGCAGATGGGTTGCTCTGG + Intergenic
1169989624 20:11486689-11486711 GAAAAGCAGAATGGTTGTATGGG - Intergenic
1172420252 20:34810530-34810552 AAGAAAAAAAATGGTTGCATGGG - Intronic
1172761268 20:37324516-37324538 GAAAAACAGAATGGTTGTACGGG - Intergenic
1173308958 20:41879044-41879066 AAGAAGGATTATGATTGCACAGG - Intergenic
1173353644 20:42267138-42267160 GAAAAGCAGAATGTTTGCACTGG - Intronic
1173362876 20:42360184-42360206 AAGGAGCAGGATGGTGACACAGG - Intronic
1174609208 20:51785363-51785385 GAGAAACAGAATGGTTGTATGGG + Intronic
1175626602 20:60493407-60493429 AAGAAGGAGGATGGTTTCAGTGG + Intergenic
1176424299 21:6538504-6538526 AGAAAGCAGAATGGTGGCACCGG + Intergenic
1177291996 21:19125366-19125388 AAGAAACAGAATGAGTGCAATGG - Intergenic
1178883979 21:36470649-36470671 GAGTAGCTGAATGGTGGCACGGG + Intronic
1179699792 21:43146819-43146841 AGAAAGCAGAATGGTGGCACCGG + Intergenic
1180819995 22:18820639-18820661 AAGAAGCAGATTGGTTCAACAGG + Intergenic
1181206217 22:21255111-21255133 AAGAAGCAGATTGGTTCAACAGG + Intergenic
1182573203 22:31254546-31254568 AAGAAGAAAGATGGTTGCCCAGG + Intronic
1182714357 22:32343852-32343874 GAGAAGCAGAATCATTCCACTGG + Intergenic
1182822382 22:33228383-33228405 AAGAAGCAGAATAGTTGTGCTGG - Intronic
1184085273 22:42258618-42258640 GAGAAGCAGAATGGTTGTGTGGG - Intronic
1203220703 22_KI270731v1_random:40312-40334 AAGAAGCAGATTGGTTCAACAGG - Intergenic
1203270121 22_KI270734v1_random:46510-46532 AAGAAGCAGATTGGTTCAACAGG + Intergenic
949902434 3:8828083-8828105 GAAAAACAGAATGGTTGCATGGG - Intronic
952217917 3:31295981-31296003 AAGTAGAAGAATGGTTGCCAGGG + Intergenic
953565708 3:44030116-44030138 AAGAAGAAAAATGGTTGTTCTGG - Intergenic
954459966 3:50620737-50620759 ATGGAGTAGAATGGCTGCACTGG - Intronic
955312844 3:57906890-57906912 AAAAAGCAGAATGATTGGAGAGG + Intronic
955920774 3:63953462-63953484 AAGAAGCAGCTTGGGAGCACTGG + Intronic
957622768 3:82616075-82616097 AATAAACACAGTGGTTGCACTGG + Intergenic
957956383 3:87193998-87194020 AAAAAACAGAATGGTTGTATGGG + Intergenic
959738105 3:109684640-109684662 GAAAAGCAGAATGGTTGTATGGG + Intergenic
960647105 3:119898221-119898243 GAAAAACAGAATGGTTGTACAGG + Intronic
960908298 3:122623267-122623289 AAGTAGCAGAGTGCTTGCCCTGG - Intronic
962016811 3:131449286-131449308 AAGAAGAAAAATGGTAGCAGTGG - Intergenic
962684706 3:137836110-137836132 AAGGAGAAGAATTGTTGCATTGG - Intergenic
962686172 3:137849959-137849981 GAGAAGCAGCATGGTTTCAGAGG + Intergenic
963371936 3:144412180-144412202 AAGAAACAGAACTGTTGCTCAGG + Intergenic
963564999 3:146918374-146918396 GAAAAGCAGAATGGTTGTATGGG - Intergenic
965678666 3:171227860-171227882 GAAAAACAGAATGGTTGTACAGG - Intronic
966515525 3:180816652-180816674 AAGAAGAAGAATGTATGCAAAGG - Intronic
966553394 3:181230525-181230547 AAGAAGCAGAATACTTCCCCTGG - Intergenic
967946939 3:194811511-194811533 ATGTAGCAGAAAGGTCGCACAGG + Intergenic
968557242 4:1251864-1251886 AGGAATCAGAACGGTTGCCCGGG - Intergenic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
970809413 4:20074154-20074176 AAGAAACAGACTGGGTGGACTGG - Intergenic
971125620 4:23750863-23750885 CAGAACAAGAATGGTTGCCCAGG + Intergenic
972254737 4:37341124-37341146 GAAAAACAGAATGGTTGTACAGG - Intronic
974058000 4:57003563-57003585 AAGAAATAGAATGGGTGCAGTGG + Intronic
974283951 4:59839382-59839404 AAGATGCAGGATTGTTACACAGG + Intergenic
974951196 4:68584609-68584631 AAGAAGCAGCAAGGTTGAAATGG + Intronic
974952914 4:68603723-68603745 AGGAAGGAAAATGGTTTCACAGG + Intronic
975566671 4:75763338-75763360 AAAAAACAGAATGGTTGTATGGG - Intronic
975903583 4:79182588-79182610 AAGAAGCAAAATGTTTGGAAAGG + Intergenic
976010302 4:80478626-80478648 CAGAAGCAAAATGGTTTCACTGG - Intronic
977084146 4:92573012-92573034 AAGAAACGGAATGCTTGAACAGG - Intronic
978714158 4:111821823-111821845 AAGAAGAAGAATGTTAACACTGG - Intergenic
979028169 4:115604132-115604154 AAGCAGCAGAGTGAATGCACTGG + Intergenic
979849303 4:125556550-125556572 AAGAAGCAGAATAGTTTCAGGGG - Intergenic
979874800 4:125874434-125874456 AAGAAATAGAATGATTGTACTGG + Intergenic
980988589 4:139718846-139718868 AAGAGGCTGGGTGGTTGCACAGG - Exonic
981434758 4:144707530-144707552 GAGAGGCAGTATGGTTGTACAGG - Intronic
982750448 4:159154801-159154823 AAGAAGCAGTATAGTAACACGGG - Intronic
982882520 4:160737890-160737912 CAGAAGCAGACTGGGTGCAGCGG - Intergenic
983740443 4:171124830-171124852 GAAAAACAGAATGGTTGCATAGG - Intergenic
984255927 4:177389961-177389983 AAGAAGCACCATGCTTGGACTGG - Intergenic
987234082 5:15925893-15925915 AAAAAACAGAATGGTTGTATGGG - Intronic
988680462 5:33480154-33480176 AAACAGCAGAATAGTTGCCCAGG + Intergenic
989609140 5:43274651-43274673 CAGGAGCAGAATGTTTGCTCTGG - Intronic
989814666 5:45721806-45721828 GAGAAGCAGAATTGTTACAAGGG + Intergenic
990555631 5:56932583-56932605 AAGAAGCAGAATGATCTCAGAGG + Intronic
990777838 5:59323478-59323500 AAGAAGCAGACTGGGGGCAAGGG - Intronic
990816406 5:59790679-59790701 AGGAAGCAGAATGGAGGCAGAGG - Intronic
990909186 5:60837040-60837062 AAAAAGCAGAAAGGGTGCTCAGG - Intronic
991461463 5:66863589-66863611 AAGAAGAAGAAAGGGTGCAGAGG - Intronic
992239967 5:74757908-74757930 AAGTAGAAGGATGGTTGCAAGGG + Intronic
994851533 5:105060069-105060091 AAGAAGCAGCAGGGTTGGAGAGG + Intergenic
996090956 5:119351387-119351409 AAAAAGCAGAATGGTTGTATGGG - Intronic
997754340 5:136382045-136382067 GAAAAGCAGAGTGGTTGCATGGG + Intronic
997784473 5:136696452-136696474 AAGAAGCAAAATTTTTACACTGG + Intergenic
1001915475 5:175556815-175556837 AAGATTCAGAATGGATGCAGAGG - Intergenic
1002737181 5:181403338-181403360 AAGAAACAGAATGGTTGTATGGG + Intergenic
1002747518 6:71441-71463 AAGAAACAGAATGGTTGTATGGG - Intergenic
1002992678 6:2252345-2252367 AATAAGCAGAATAGAAGCACTGG + Intergenic
1003649939 6:7950251-7950273 AAAAAGCAAAATGATTGCAAGGG - Intronic
1004078612 6:12368836-12368858 AAAAAGCAGAATGTATGGACTGG + Intergenic
1005277836 6:24238677-24238699 AAGAATCAGGATGTTTTCACTGG + Intronic
1006294787 6:33165474-33165496 AACAAGCAGAATGGATGCTGGGG - Intronic
1006663103 6:35665843-35665865 AAAAAGCAGAATAGTTGTATGGG - Intronic
1009901389 6:69811759-69811781 AGGAAGCAGACAAGTTGCACTGG + Intergenic
1011949491 6:92946544-92946566 GAAAAGCAGAATGGTTGTACAGG + Intergenic
1012366814 6:98451138-98451160 AGGAAGCAGAAAGGTTGCAAAGG + Intergenic
1014279400 6:119424020-119424042 AACATGCAGATTTGTTGCACAGG - Intergenic
1016684115 6:146862224-146862246 AAGCACCAGAATAGCTGCACTGG + Intergenic
1016811598 6:148266355-148266377 AATAAGAAGAATGTTTGCATAGG + Intergenic
1016944087 6:149512011-149512033 AAGAAGCAGAATGGTTGCACTGG - Intronic
1018735794 6:166686358-166686380 AAAAAGCAGAAAAGTTGCTCAGG - Intronic
1019242277 6:170678904-170678926 AAGAAACAGAATGGTTGTATGGG + Intergenic
1019840357 7:3435942-3435964 AAAAAGCAGAACTGTTGCTCTGG + Intronic
1022174653 7:27861754-27861776 AAAAAGCAGATTGGATGCTCTGG + Intronic
1024124435 7:46278015-46278037 GAAAAGCAGAATGGTTGTATGGG - Intergenic
1026071102 7:67120368-67120390 AAGAAACAGACTGGGTGCAGTGG - Intronic
1027822389 7:83063444-83063466 AAAAAGCAGAAGGGTTGTATGGG - Intronic
1029491383 7:100872318-100872340 AAGAAGAAGACTGGGTGCAGTGG - Intronic
1030703058 7:112662277-112662299 AAGAGGCAGTCTGGCTGCACTGG + Intergenic
1031018925 7:116605546-116605568 GAAAAACAGAATGGTTGCATGGG + Intergenic
1031560481 7:123232199-123232221 AAGAAGGAGAATGTTTCCTCAGG - Intergenic
1032001404 7:128267829-128267851 AAGAATGAGCATGGTGGCACGGG - Intergenic
1034013782 7:147559629-147559651 AAGAAGGGGAATGGTTTCAATGG + Intronic
1035255628 7:157624606-157624628 GAGTAACAGAATGGTTGCATGGG + Intronic
1035505841 8:129246-129268 AAGAAACAGAATGGTTGTATGGG - Intergenic
1037720347 8:21438545-21438567 AAGAGGTAAAATGGGTGCACAGG + Intergenic
1038055111 8:23850756-23850778 AAAAAGCAAAATGGCTGGACTGG - Intronic
1039034643 8:33346496-33346518 AAGAAACAGAATGATTCCAAAGG - Intergenic
1039777358 8:40750344-40750366 GAGAAGCAGAATGGTCACAGGGG + Intronic
1041745428 8:61203549-61203571 AAAAAAAAGAATGGTAGCACAGG + Intronic
1043375633 8:79646486-79646508 AAGAAGCACAAAGGTAGCAAGGG + Intronic
1047531849 8:125684150-125684172 AAGAGGCAGGAGGGTTGCATGGG - Intergenic
1048929520 8:139301188-139301210 GAAAAGCAGAATGGTTGTAGGGG + Intergenic
1050348562 9:4717656-4717678 GAAAAGCAGGATGGTTGTACAGG - Intronic
1050630809 9:7556432-7556454 AAGAGGCAGTATGGTGGCAGTGG + Intergenic
1051502157 9:17789862-17789884 AAAAAACAGAATGGTTGTAAGGG + Intronic
1052157367 9:25209241-25209263 ACAAAGCAGAATAGTTGAACTGG + Intergenic
1052200913 9:25778823-25778845 GAAAAGCAGAATGGTTGTATGGG + Intergenic
1055191956 9:73535807-73535829 AAAAATCAGAATGGTTGCATGGG - Intergenic
1055373996 9:75628974-75628996 AAGAAACAGAATGGTTCAGCAGG + Intergenic
1056428842 9:86506624-86506646 AAGAAACAGCAAGGATGCACTGG + Intergenic
1060483685 9:124033481-124033503 AGGAATCAGAATGGTGACACGGG + Intergenic
1062603009 9:137328557-137328579 AAGAAACAGACTAGTTACACAGG + Intronic
1203602468 Un_KI270748v1:28126-28148 AAGAAACAGAATGGTTGTATGGG + Intergenic
1188504740 X:30870094-30870116 AAGAAGCAAAATGGAAGTACTGG + Intronic
1189101253 X:38192459-38192481 AAGTAGCAGGATGATTGTACAGG - Intronic
1189265336 X:39711457-39711479 CAGAAACAGAATGGTTGTATGGG + Intergenic
1190575691 X:51835386-51835408 GAAAAGCAGAATGGTTGTATTGG + Intronic
1192432244 X:71120228-71120250 AAGAAGGAGGATGGTTCCAAGGG - Intronic
1192618061 X:72648538-72648560 AATGAGCAGAGTGGTGGCACTGG - Intronic
1193197937 X:78656363-78656385 AAGAGGCAGAGTCGTTGTACAGG + Exonic
1193657910 X:84220929-84220951 AAGAAGCAGAGGGGTTTCAGAGG + Intergenic
1196101872 X:111855214-111855236 GAGAAGAAGAATGGTTGTGCTGG - Intronic
1196836187 X:119816172-119816194 AAGTAGAAGAAAGGTGGCACTGG + Intergenic
1197337039 X:125221032-125221054 AAGAAGCAGACAAGTGGCACTGG - Intergenic
1197645666 X:129013808-129013830 ACGCAGCAAAAGGGTTGCACTGG + Intergenic
1198826435 X:140702993-140703015 AAGCAGCAGCATGGTTTCAGAGG - Intergenic
1198839513 X:140841445-140841467 AAGAAGCATAATGCTTGGAAGGG - Intergenic
1200755571 Y:6987022-6987044 CAGAACCAGTATGGTTGCATGGG + Intronic