ID: 1016948355

View in Genome Browser
Species Human (GRCh38)
Location 6:149555580-149555602
Sequence ACTGATATCCAGAATCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016948351_1016948355 24 Left 1016948351 6:149555533-149555555 CCCACAGAGTGGACAAAAATTTT No data
Right 1016948355 6:149555580-149555602 ACTGATATCCAGAATCTGCAAGG No data
1016948352_1016948355 23 Left 1016948352 6:149555534-149555556 CCACAGAGTGGACAAAAATTTTC No data
Right 1016948355 6:149555580-149555602 ACTGATATCCAGAATCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016948355 Original CRISPR ACTGATATCCAGAATCTGCA AGG Intergenic
No off target data available for this crispr