ID: 1016949737

View in Genome Browser
Species Human (GRCh38)
Location 6:149567438-149567460
Sequence AAGTGTCACTTTGACCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016949732_1016949737 30 Left 1016949732 6:149567385-149567407 CCTAGTCAAGACTTGAATATGAA 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1016949737 6:149567438-149567460 AAGTGTCACTTTGACCAACAAGG 0: 1
1: 0
2: 1
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016949737 Original CRISPR AAGTGTCACTTTGACCAACA AGG Intronic
901250793 1:7777819-7777841 AAGTGACACTTTGAGACACAGGG + Intronic
907717875 1:56944441-56944463 AAGAGCAACTTTGACCACCAGGG + Intronic
918670763 1:187212537-187212559 AAAGCTCACTTTGACCTACAAGG - Intergenic
920214432 1:204351871-204351893 AAGTTTCACCATGCCCAACATGG + Intronic
920919041 1:210282905-210282927 AAGTGTGACTGAGATCAACATGG - Intergenic
921535065 1:216338681-216338703 AAGTGTAACTTTTACTGACAAGG + Intronic
921638926 1:217528683-217528705 AACTGGCACCTTGTCCAACAGGG + Intronic
922544920 1:226449343-226449365 AATTGTCACCTTGGCCAACCAGG - Intergenic
922851986 1:228740535-228740557 AACTGCCACTTTGACCAGCTTGG - Intronic
923090751 1:230739405-230739427 AAGAGTCACCTTGTCCACCAGGG + Intergenic
923731506 1:236555542-236555564 AAGCGTCACCTTGAAGAACAGGG + Exonic
1064054746 10:12087917-12087939 AAGTCTCACTTTGTTCCACAGGG - Intronic
1067775060 10:49157477-49157499 AAGAATCACATAGACCAACAAGG + Intronic
1068014123 10:51493268-51493290 AAATTTTACTTTGTCCAACATGG + Intronic
1069271877 10:66539078-66539100 AGATGACACTTTGAACAACAAGG - Intronic
1071901501 10:90125180-90125202 AAGTTTATCTTTGACCAAGAAGG + Intergenic
1072027766 10:91479011-91479033 AAGTGTCAGTCTGGCCAACATGG + Intronic
1073892909 10:108121698-108121720 AGGTCTCCCTTTGAGCAACACGG - Intergenic
1077930635 11:6728661-6728683 AAATGTCACTTTGTCCAAGCTGG - Intergenic
1082054119 11:47798898-47798920 ACCTGTCATTCTGACCAACACGG + Intronic
1084105856 11:66979961-66979983 AAGTGTAACTTTGAACTACTGGG + Intergenic
1090837918 11:130466777-130466799 CAGTGTCACTAGGGCCAACAAGG - Intronic
1093552858 12:20436036-20436058 AAGTCTTACTTTGAGTAACAAGG - Intronic
1093559171 12:20517360-20517382 ATGTGACACTTTGAACAACGGGG + Intronic
1095498310 12:42808874-42808896 ATGTGTTACTTTGCACAACACGG - Intergenic
1097590556 12:61569378-61569400 AAGTGTCACTTAGACTATCATGG - Intergenic
1099759813 12:86904941-86904963 AAGTGTCTCTTTGACCTGAAAGG - Intergenic
1100585172 12:95972760-95972782 AAGTGTCATTTTGACCTGGAGGG + Exonic
1102034752 12:109764873-109764895 AAATGTCACTTTGGCCAACGGGG - Intronic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107887964 13:44890348-44890370 ATGTGTCACCATGACCACCATGG + Intergenic
1108082855 13:46755317-46755339 ATGTATCACTTTGATAAACAGGG - Intergenic
1109847071 13:68007537-68007559 ATGTGTCATTTTGACAATCATGG - Intergenic
1111167790 13:84484788-84484810 AAATGTCACTTTTCCCAAAAAGG - Intergenic
1114402642 14:22423824-22423846 ACCTGTCATTTTGCCCAACATGG + Intergenic
1116790272 14:49332507-49332529 TTGTGTCACTTGGAGCAACATGG + Intergenic
1117281616 14:54246999-54247021 AAGGGAGACTTTGACCAACAGGG - Intergenic
1118933904 14:70268555-70268577 AAGTCTCCCTTTGAGCAAAATGG + Intergenic
1120209300 14:81619178-81619200 GAATTTCACTTGGACCAACACGG - Intergenic
1126777792 15:52113950-52113972 CAGTGGGACTTTGTCCAACAGGG + Intergenic
1127883713 15:63180275-63180297 AGGAGTCACTTCAACCAACAGGG - Intergenic
1135380319 16:21990766-21990788 AAGTGTGACTTTTATCAAGAGGG + Intronic
1141759330 16:86017206-86017228 AAGTGACACCTTGAACAAGAAGG - Intergenic
1146967954 17:37048801-37048823 AAGTGTCTCTATGACCTAAAAGG - Intronic
1155211863 18:23608896-23608918 AACTTTCACTTTGAGAAACAGGG - Intronic
1158238149 18:55343086-55343108 AAGTGTCACTGTTACCATTAGGG - Intronic
1161792338 19:6367901-6367923 AAGTTTCACCATGGCCAACATGG - Intronic
1163128477 19:15257375-15257397 AAATCTCACTTTGAAGAACAAGG + Intronic
1166015830 19:39978706-39978728 AAGTGTAACTTTAAGAAACAAGG + Intronic
930481177 2:51950274-51950296 AACTGCCATTTTGAACAACATGG - Intergenic
934163255 2:89272084-89272106 GAGGGTCACTTTCACCAGCAGGG - Intergenic
934204018 2:89910440-89910462 GAGGGTCACTTTCACCAGCAGGG + Intergenic
935468942 2:103433771-103433793 AGGTTTTACTTAGACCAACAAGG - Intergenic
938984480 2:136560757-136560779 AAGTGTTACATTGGCCAAAAAGG - Intergenic
939107048 2:137961548-137961570 AATTTACACTCTGACCAACAGGG - Intergenic
939241630 2:139568472-139568494 TATTGTCACTTTCAACAACACGG + Intergenic
942191932 2:173478845-173478867 AAATGTGGCTTTGACCAAGATGG - Intergenic
942296803 2:174525349-174525371 GAGTATCACATTGACCAACAAGG + Intergenic
944277563 2:197856222-197856244 CAGTGTCACTATGACCTACGGGG - Intronic
945168482 2:206971020-206971042 TATTGTGACTGTGACCAACAAGG - Intergenic
945931862 2:215863221-215863243 AAGATTCACCTTTACCAACATGG - Intergenic
946391192 2:219418012-219418034 AAGTCTCTCCTTGACCAAAAAGG + Intergenic
947725495 2:232396852-232396874 CATTGCCACCTTGACCAACAGGG + Intergenic
1168912198 20:1457732-1457754 AATTGTCATTTTCAACAACATGG - Intronic
1173011461 20:39186959-39186981 AATTGTCCCTTGGTCCAACAGGG + Intergenic
1178083029 21:29085237-29085259 AAGTGACAGCTAGACCAACAAGG + Intronic
1179677402 21:42993014-42993036 GAGTGTCACTATGAACAAGATGG + Intronic
1182344482 22:29651610-29651632 AAATGTCTCTTTAAACAACAAGG - Intronic
1184735580 22:46395803-46395825 AAGCGTCACTTTGTCCAAGGTGG - Intronic
954312448 3:49780691-49780713 AAGTGGCACTTTAACCAGGAAGG + Intronic
955228787 3:57081177-57081199 ATGTCTCACTTTGTCCATCAAGG - Intergenic
959080001 3:101790223-101790245 AAATGTCAGTTAGATCAACATGG + Intronic
959613278 3:108318362-108318384 AAATTCCACTTTGACAAACATGG + Intronic
964338048 3:155678413-155678435 AAGTGTCTGTTTGACCACAAAGG + Intronic
967621189 3:191636367-191636389 AAGTGGCATTTTGAGCACCATGG + Intergenic
967962609 3:194938117-194938139 TGCTGGCACTTTGACCAACAAGG - Intergenic
971141594 4:23930883-23930905 AAGTGACACACTAACCAACATGG + Intergenic
972218080 4:36919828-36919850 AAGTGTCTCTTTAATGAACATGG + Intergenic
972937926 4:44162147-44162169 AAGAGACAATTTGACCAACACGG - Intergenic
976218287 4:82735114-82735136 AAGTGTCATTTTGATCAACATGG + Intronic
976688229 4:87839694-87839716 AAGGGTCACTATGAGAAACATGG + Intronic
976835124 4:89363247-89363269 AAGTGCCCCCCTGACCAACAAGG - Intergenic
977346486 4:95822882-95822904 AAGTGTCTCTTTGAACAGGAGGG - Intergenic
978923597 4:114216785-114216807 AAGAGACCCTTTGACCACCATGG + Intergenic
979718983 4:123876553-123876575 AAGTGGCAAATTGACCAGCAAGG + Intergenic
980993499 4:139759124-139759146 AAATGTCAGTTTGAACATCAGGG - Intronic
986229797 5:5852785-5852807 TAGTCTCACGATGACCAACAAGG - Intergenic
986589575 5:9354748-9354770 GAGTGTGACTTAGAGCAACATGG + Intronic
986611809 5:9575823-9575845 AAGTCTCACTTTGAGGAACAAGG + Intergenic
987685856 5:21200011-21200033 TACTGTCACTTTCAGCAACATGG - Intergenic
988964190 5:36400220-36400242 AAAACTCACTTTGGCCAACATGG - Intergenic
993921732 5:93813610-93813632 AACTGTCAGTTTGACCTACAGGG + Intronic
997354476 5:133253559-133253581 AGGCGTCACTTTTACCATCATGG - Intronic
1002974866 6:2064651-2064673 AAGTGTAACTGTCAGCAACAGGG - Intronic
1004342983 6:14823747-14823769 AAGGGTGACTTGGACCAACGTGG + Intergenic
1005875141 6:30005795-30005817 AAGTTTCACTTTTGCAAACAAGG - Intergenic
1008008946 6:46443118-46443140 AAATGTCACTTTTACCTATAAGG + Intronic
1010042158 6:71397606-71397628 AAACGTCACTATGACCTACAAGG + Intergenic
1014058699 6:117045971-117045993 AAATGTCAATTTGATCAACTTGG + Intergenic
1014789071 6:125651095-125651117 AAGTGTCAGCCTGGCCAACATGG - Intergenic
1016949737 6:149567438-149567460 AAGTGTCACTTTGACCAACAAGG + Intronic
1017353410 6:153472302-153472324 AAGTTTCACTTAGAGCTACAGGG - Intergenic
1017752691 6:157503124-157503146 AACTGTCACACAGACCAACATGG - Intronic
1021256097 7:18394201-18394223 GAGTGTCCCTTTAACAAACAAGG - Intronic
1022592663 7:31680688-31680710 AAGTGTCACTGTGACCAAAGGGG - Intergenic
1030971740 7:116065719-116065741 ATGTATCACTTTGATCAAAATGG + Intronic
1033118304 7:138645491-138645513 AAGTGTCAGAATAACCAACAGGG - Intronic
1043485444 8:80694519-80694541 AATTGTCACTTTGACAAATGTGG + Intronic
1043516346 8:80998431-80998453 AGGTGTCACTTTTAACCACAAGG + Intronic
1047797391 8:128272040-128272062 AAGATTTACTTTGGCCAACAAGG - Intergenic
1048949693 8:139485659-139485681 AAGAGGCAATGTGACCAACACGG - Intergenic
1053584086 9:39437925-39437947 CAGTGTCACTTTGAGAAAAATGG + Intergenic
1054105667 9:60996669-60996691 CAGTGTCACTTTGAGAAAAATGG + Intergenic
1060143824 9:121234059-121234081 AAGTGTCATCTTGACCCACGAGG - Intronic
1185502724 X:610659-610681 AAGTGGCACATTCACCAAAATGG - Intergenic
1185721012 X:2381420-2381442 AAGTGTGAGCCTGACCAACAGGG + Intronic
1188523458 X:31063397-31063419 AACTGACACTTTGGCCAACAAGG + Intergenic
1188538751 X:31226062-31226084 AAATCACACTTTGACTAACAAGG - Intronic
1188852579 X:35150475-35150497 AAGAGACGCTTTGACCACCATGG + Intergenic
1194167577 X:90538753-90538775 AAGTGTGACTTTGAACACTATGG - Intergenic
1197067085 X:122246201-122246223 AACTATCACTTTGATAAACATGG - Intergenic
1197275476 X:124474067-124474089 AAGTCTCAGATTGACCTACAAGG + Intronic
1197454531 X:126661873-126661895 AAGTGTTTCTGTGACCAACAAGG + Intergenic
1200513834 Y:4116533-4116555 AAGTGTGACTTTGAACACTATGG - Intergenic