ID: 1016950749

View in Genome Browser
Species Human (GRCh38)
Location 6:149577298-149577320
Sequence GTTCCACGAAGGAGACCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016950743_1016950749 26 Left 1016950743 6:149577249-149577271 CCTGTACCTTAGTCTTTGGGCTT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1016950749 6:149577298-149577320 GTTCCACGAAGGAGACCCACGGG 0: 1
1: 0
2: 1
3: 10
4: 73
1016950745_1016950749 20 Left 1016950745 6:149577255-149577277 CCTTAGTCTTTGGGCTTACGGAC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1016950749 6:149577298-149577320 GTTCCACGAAGGAGACCCACGGG 0: 1
1: 0
2: 1
3: 10
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016950749 Original CRISPR GTTCCACGAAGGAGACCCAC GGG Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
900985918 1:6072773-6072795 GTCCCAGGCAGGAGACCCGCAGG - Exonic
900986133 1:6073714-6073736 GTTCCTGGAAGGAGACACAGGGG - Exonic
903747455 1:25597578-25597600 GTCCCACGCAGGAGAGACACAGG + Intergenic
906179403 1:43805387-43805409 GTTCCCTGAAGGAAACCCAAGGG + Intronic
913962904 1:143353532-143353554 GTTCCCCAACGGAGACCCTCGGG + Intergenic
914057259 1:144179117-144179139 GTTCCCCAACGGAGACCCTCGGG + Intergenic
914121887 1:144787249-144787271 GTTCCCCAACGGAGACCCTCGGG - Intergenic
919784592 1:201251223-201251245 GGACAACGAAGGAGACCCAGCGG - Intergenic
1063299176 10:4836391-4836413 GTTCCTGGAAGTTGACCCACAGG + Intronic
1070526170 10:77297859-77297881 ATTCCAAGATGGAGACCCAAAGG + Intronic
1072786035 10:98283100-98283122 GTTCCAACAAAGAGAACCACAGG - Intergenic
1075548841 10:123377074-123377096 ATGCCATGAAGGAGACACACGGG - Intergenic
1079112163 11:17611001-17611023 GTCCCACGAAAGAGCACCACAGG + Exonic
1083291862 11:61695011-61695033 ATTCCAGGAAGCAGCCCCACGGG + Intronic
1083891113 11:65596226-65596248 GTTCCATGAAGGAAACACCCTGG + Intronic
1096077487 12:48814587-48814609 GTGTCTCGAAGGAGCCCCACGGG + Intronic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1101054169 12:100895067-100895089 GTTCCAGGAAGGCGAAGCACTGG + Intronic
1102743055 12:115224866-115224888 CTTCCACAAAGCAGACCCACAGG + Intergenic
1104914752 12:132258846-132258868 CGTCCACGCTGGAGACCCACAGG + Intronic
1108948581 13:56057781-56057803 TTTCCACAAAGCAGTCCCACTGG - Intergenic
1124156819 15:27233246-27233268 GTTCCACGAAATAAAACCACTGG - Intronic
1128311322 15:66633164-66633186 GTCCCAAGAAGGAGACAGACAGG - Intronic
1128705416 15:69834556-69834578 GACCCACAAAGGAGCCCCACAGG - Intergenic
1133293845 16:4740401-4740423 CTGCCATGAAGGAGACCCAAAGG + Exonic
1134162738 16:11904965-11904987 GTCCCACGCAGGAGAATCACTGG + Intronic
1137537296 16:49337158-49337180 GTGCCATGAAGGAGACCAAGAGG + Intergenic
1137588830 16:49681071-49681093 TTTCCAAGTAGGAGACCAACAGG + Intronic
1138528245 16:57620943-57620965 GTTCCATGAAGGAGAGGCAGGGG + Intronic
1140834182 16:78778242-78778264 GCTCCACAAAGGAGACACAGGGG - Intronic
1141428620 16:83959372-83959394 GGTCCAGGATGGAGACCCCCGGG - Exonic
1143751902 17:9034253-9034275 GGTACAGGAAGGAGACCCAGAGG + Intronic
1144330454 17:14219110-14219132 GTTCCCCTAAGGAGGTCCACGGG - Intergenic
1151961743 17:77409316-77409338 CCACCACGAAGGAGACACACCGG - Intronic
1154338127 18:13482112-13482134 CTTCCAGGAAGGAGACCCAGTGG + Intronic
1158556227 18:58476991-58477013 GTTCCAGACAGGATACCCACTGG + Intergenic
1160490704 18:79334858-79334880 GTTCCAGGTAGGAGACCCACCGG + Intronic
1161073414 19:2273605-2273627 CTCCCACGGAGGAGACCCCCTGG + Intronic
1163209355 19:15829220-15829242 GTCTCACGAAGGAGTCCCCCTGG - Intergenic
1167132191 19:47594160-47594182 GTTCCACGAGGTAGACCCCAGGG + Intergenic
1202696742 1_KI270712v1_random:131790-131812 GTTCCCCAACGGAGACCCTCGGG + Intergenic
932039318 2:68282225-68282247 GATCTACTAAGGATACCCACGGG - Intergenic
934277895 2:91588804-91588826 GTTCCCCAACGGAGACCCTCGGG + Intergenic
941005844 2:160246116-160246138 GTTACACCAAGGAAACCCCCTGG - Intronic
948518278 2:238519782-238519804 GTTCCAAGGAGGAGGACCACAGG - Intergenic
1170550845 20:17474708-17474730 GTCCCAAGAAGGAGCCTCACTGG - Intronic
1172982752 20:38956763-38956785 GTTACATGAAGGAAACCCAAGGG + Intergenic
1173465703 20:43279534-43279556 CTTCCACTAAGGATACCCAGGGG + Intergenic
1174914590 20:54641735-54641757 GTACCACGAAGGAGACACAGGGG - Intronic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1175874869 20:62224566-62224588 GTTCCAGGAAGGAGAACAGCAGG + Intergenic
1182692920 22:32176241-32176263 GTTCCACGAGGGCGTCCCAGAGG + Intergenic
1184675393 22:46039201-46039223 GCTCCAGGAAGGAAACACACAGG + Intergenic
1185394793 22:50581440-50581462 CTTTCACCAAGGAGCCCCACTGG - Exonic
949958889 3:9294976-9294998 GTTCCACGAAGGAAACTCCTAGG + Intronic
956975398 3:74573114-74573136 GACCCATGAAGGGGACCCACAGG + Intergenic
961452358 3:127008151-127008173 GTGTCACGAAGGACACCCAGGGG - Intronic
968385069 4:128611-128633 GATCCACGGAGGAGACACTCAGG - Intronic
968804152 4:2761864-2761886 GTGCCAGGTAGGAGCCCCACAGG - Intergenic
969032849 4:4227531-4227553 GTTCCCCAACGGAGACCCTCGGG - Intergenic
970834613 4:20387665-20387687 GTTCCCAGATGGAGGCCCACGGG + Intronic
970918368 4:21363241-21363263 GTTCAATGAAGGAGAGCCACAGG - Intronic
971821631 4:31564560-31564582 GTTCAACAAAGGAGATACACAGG + Intergenic
979403092 4:120274876-120274898 GGTCCACGAAGGAGGGTCACTGG + Intergenic
983939540 4:173525486-173525508 GTTCCAGGATGGAAACCCTCTGG + Intronic
985624629 5:978738-978760 ATTTCCCTAAGGAGACCCACAGG - Intergenic
987192489 5:15492652-15492674 GTACCAGGGATGAGACCCACTGG + Intergenic
995887178 5:116908574-116908596 GTGCCATGAAGGAGAAACACAGG - Intergenic
1003727148 6:8777764-8777786 GTGCCACTAAGGTGACCCACTGG + Intergenic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1008581686 6:52913908-52913930 CTGCCAGCAAGGAGACCCACTGG + Intergenic
1016950749 6:149577298-149577320 GTTCCACGAAGGAGACCCACGGG + Intronic
1017790998 6:157799389-157799411 CTTGCCCCAAGGAGACCCACTGG - Intronic
1026955185 7:74372456-74372478 CCTCCACACAGGAGACCCACAGG - Intronic
1039386783 8:37143158-37143180 GCTGCAAGAAGGAGACCCCCAGG + Intergenic
1051222074 9:14859426-14859448 GTTCCAGGAGATAGACCCACAGG + Exonic
1056993429 9:91431867-91431889 GATCCAGGAAGGAGACACACTGG - Intergenic
1057502387 9:95605921-95605943 GCTCCAAGAAGGAGACCCTCGGG - Intergenic
1057869945 9:98709519-98709541 GTTCCACGAAGGCGTCCCAGAGG + Intergenic
1060909512 9:127338342-127338364 GTTCCATGAAGGAGACCTAGGGG + Intronic
1061809617 9:133154791-133154813 GTTCCAGGAAGGAGTCCCAGAGG + Intronic
1192194369 X:69018629-69018651 GTTCCATGAAGGGGGCACACAGG + Intergenic
1196787020 X:119429713-119429735 GTGCCATGAAGGAGAAGCACAGG + Intronic
1201719641 Y:17082514-17082536 GTTCCACACAGGAGAGACACAGG - Intergenic