ID: 1016952574

View in Genome Browser
Species Human (GRCh38)
Location 6:149594468-149594490
Sequence TGTGCTGGCCTCGGACACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016952574_1016952581 10 Left 1016952574 6:149594468-149594490 CCTTCGTGTCCGAGGCCAGCACA No data
Right 1016952581 6:149594501-149594523 AGGCTGCCGTGGCCGCATCGTGG 0: 1
1: 0
2: 2
3: 4
4: 84
1016952574_1016952578 -1 Left 1016952574 6:149594468-149594490 CCTTCGTGTCCGAGGCCAGCACA No data
Right 1016952578 6:149594490-149594512 ACCAAGACCACAGGCTGCCGTGG 0: 1
1: 0
2: 3
3: 33
4: 177
1016952574_1016952582 11 Left 1016952574 6:149594468-149594490 CCTTCGTGTCCGAGGCCAGCACA No data
Right 1016952582 6:149594502-149594524 GGCTGCCGTGGCCGCATCGTGGG 0: 1
1: 0
2: 2
3: 10
4: 62
1016952574_1016952576 -10 Left 1016952574 6:149594468-149594490 CCTTCGTGTCCGAGGCCAGCACA No data
Right 1016952576 6:149594481-149594503 GGCCAGCACACCAAGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016952574 Original CRISPR TGTGCTGGCCTCGGACACGA AGG (reversed) Intergenic