ID: 1016952575

View in Genome Browser
Species Human (GRCh38)
Location 6:149594477-149594499
Sequence TGGTCTTGGTGTGCTGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016952575_1016952581 1 Left 1016952575 6:149594477-149594499 CCGAGGCCAGCACACCAAGACCA No data
Right 1016952581 6:149594501-149594523 AGGCTGCCGTGGCCGCATCGTGG 0: 1
1: 0
2: 2
3: 4
4: 84
1016952575_1016952582 2 Left 1016952575 6:149594477-149594499 CCGAGGCCAGCACACCAAGACCA No data
Right 1016952582 6:149594502-149594524 GGCTGCCGTGGCCGCATCGTGGG 0: 1
1: 0
2: 2
3: 10
4: 62
1016952575_1016952585 30 Left 1016952575 6:149594477-149594499 CCGAGGCCAGCACACCAAGACCA No data
Right 1016952585 6:149594530-149594552 CTAAGAAGAAGTAAGTCTGTAGG 0: 1
1: 0
2: 7
3: 12
4: 140
1016952575_1016952578 -10 Left 1016952575 6:149594477-149594499 CCGAGGCCAGCACACCAAGACCA No data
Right 1016952578 6:149594490-149594512 ACCAAGACCACAGGCTGCCGTGG 0: 1
1: 0
2: 3
3: 33
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016952575 Original CRISPR TGGTCTTGGTGTGCTGGCCT CGG (reversed) Intergenic