ID: 1016952577

View in Genome Browser
Species Human (GRCh38)
Location 6:149594483-149594505
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 6, 3: 24, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016952577_1016952585 24 Left 1016952577 6:149594483-149594505 CCAGCACACCAAGACCACAGGCT 0: 1
1: 0
2: 6
3: 24
4: 196
Right 1016952585 6:149594530-149594552 CTAAGAAGAAGTAAGTCTGTAGG 0: 1
1: 0
2: 7
3: 12
4: 140
1016952577_1016952582 -4 Left 1016952577 6:149594483-149594505 CCAGCACACCAAGACCACAGGCT 0: 1
1: 0
2: 6
3: 24
4: 196
Right 1016952582 6:149594502-149594524 GGCTGCCGTGGCCGCATCGTGGG 0: 1
1: 0
2: 2
3: 10
4: 62
1016952577_1016952581 -5 Left 1016952577 6:149594483-149594505 CCAGCACACCAAGACCACAGGCT 0: 1
1: 0
2: 6
3: 24
4: 196
Right 1016952581 6:149594501-149594523 AGGCTGCCGTGGCCGCATCGTGG 0: 1
1: 0
2: 2
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016952577 Original CRISPR AGCCTGTGGTCTTGGTGTGC TGG (reversed) Intergenic