ID: 1016952577

View in Genome Browser
Species Human (GRCh38)
Location 6:149594483-149594505
Sequence AGCCTGTGGTCTTGGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 6, 3: 24, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016952577_1016952582 -4 Left 1016952577 6:149594483-149594505 CCAGCACACCAAGACCACAGGCT 0: 1
1: 0
2: 6
3: 24
4: 196
Right 1016952582 6:149594502-149594524 GGCTGCCGTGGCCGCATCGTGGG 0: 1
1: 0
2: 2
3: 10
4: 62
1016952577_1016952585 24 Left 1016952577 6:149594483-149594505 CCAGCACACCAAGACCACAGGCT 0: 1
1: 0
2: 6
3: 24
4: 196
Right 1016952585 6:149594530-149594552 CTAAGAAGAAGTAAGTCTGTAGG 0: 1
1: 0
2: 7
3: 12
4: 140
1016952577_1016952581 -5 Left 1016952577 6:149594483-149594505 CCAGCACACCAAGACCACAGGCT 0: 1
1: 0
2: 6
3: 24
4: 196
Right 1016952581 6:149594501-149594523 AGGCTGCCGTGGCCGCATCGTGG 0: 1
1: 0
2: 2
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016952577 Original CRISPR AGCCTGTGGTCTTGGTGTGC TGG (reversed) Intergenic
900638568 1:3677274-3677296 AGGCTGAGGTCTGGGTTTGCCGG + Intronic
900720946 1:4175377-4175399 AGCCTGTGGTATTTGTGTTATGG + Intergenic
900879612 1:5371288-5371310 CGGCTGTTGGCTTGGTGTGCTGG - Intergenic
902395096 1:16128251-16128273 AGCCTGTGGCCCTGCTGGGCTGG + Intronic
902690740 1:18108920-18108942 AGCGTGTGGTTATCGTGTGCAGG + Intronic
904091143 1:27945847-27945869 AGCCTGGGGTCCTAGTGTCCTGG + Intronic
905517006 1:38569370-38569392 ATCCTGTGGACTTTGGGTGCTGG + Intergenic
905939514 1:41852174-41852196 AGCCTGGGGTCTGAGAGTGCTGG - Intronic
906088396 1:43156212-43156234 AGCCTGCGGTCATGGCGTTCTGG - Exonic
906787468 1:48628636-48628658 AGCTTCTGGGCTTGGTGTGCAGG - Intronic
907240541 1:53078671-53078693 TGCCTGTGATCTGGTTGTGCAGG - Exonic
911157729 1:94653507-94653529 AGGATGTGGTCTTGGTGAGGAGG + Intergenic
912507149 1:110164125-110164147 AGCCTCTGTTCTAGGTGTGAGGG - Intronic
915610665 1:156989389-156989411 AGTCTGTGGTGGTGGAGTGCTGG - Intronic
916734100 1:167591787-167591809 AGCCAGTGGTCTTGGCATGCTGG - Intergenic
916887681 1:169086052-169086074 AGCCTGAGGTCATGGGCTGCAGG + Intergenic
917969952 1:180199965-180199987 AGCCTGTCCTCTGGGTGTGGGGG + Exonic
919940152 1:202280899-202280921 AGCCTGGAGTCTTGGAGTGGAGG + Intronic
922661098 1:227430921-227430943 AGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1064268618 10:13845900-13845922 AGCCTGTGCTCTCAGCGTGCTGG + Intronic
1065746239 10:28845180-28845202 AGCCTGCTGTCTTGGTGTATTGG - Intergenic
1067092067 10:43272259-43272281 AGTCTGTGGCCTTGGGGTGGGGG + Intergenic
1067173542 10:43926649-43926671 CCCCTGTGGTCTTGGTGCCCTGG - Intergenic
1070390723 10:75968132-75968154 GGTCTGTGGTCTTGGTGGACAGG + Intronic
1070827751 10:79401116-79401138 AGCCTGGAGTCTTGGCGTGCAGG - Intronic
1073086648 10:100895272-100895294 ACCCTGTGGTCTGGGTGCGGTGG - Intergenic
1074783083 10:116816158-116816180 AGCCAGTGGTCTTTGCGTGAGGG - Intergenic
1076457574 10:130611379-130611401 GGACTGTTGTCTTGGTGTGTGGG + Intergenic
1076837872 10:133030182-133030204 AGCCTGTGGTTTGGGTTTCCCGG - Intergenic
1077111447 11:863915-863937 AGCCTGTGGTCTTGCTGGAGGGG + Intronic
1077436298 11:2540776-2540798 AGCCTGGGGACTTGCTGTGAGGG + Intronic
1078542329 11:12222276-12222298 AGCCTGTGGTCGTGGGGAGCAGG + Intronic
1078668755 11:13346790-13346812 AGCCTGTGGTCCTGGAGTCAGGG - Intronic
1079392654 11:20035916-20035938 AGCCTGAGGTTTTGGTGCTCAGG + Intronic
1081720875 11:45287224-45287246 TGGCTGTGCTCTAGGTGTGCTGG + Intergenic
1082976817 11:59080824-59080846 AGCCCGTGTTTATGGTGTGCAGG - Intergenic
1083178866 11:60971638-60971660 TGCTTGTGGTTTTGGTCTGCAGG - Intergenic
1083401007 11:62423594-62423616 TGCCTGTGGACTTGGAGTGAAGG - Intergenic
1083756825 11:64796413-64796435 GGCCTGGGGTGTTGGTGGGCAGG + Intronic
1084191524 11:67501428-67501450 AGCCTTTGGCCCTGGTGTTCAGG - Intronic
1085399297 11:76225994-76226016 GGCCTTTGGGCTGGGTGTGCAGG - Intergenic
1087582229 11:100072254-100072276 AGCCTGGAGTCTTGCTTTGCAGG - Intronic
1088642763 11:111889360-111889382 AGCAAGTGTACTTGGTGTGCTGG + Intergenic
1088988260 11:114928857-114928879 AGCCTGTGGTTTTCTTGGGCTGG - Intergenic
1090317215 11:125803622-125803644 AGCCTGGAGTCTGGGTCTGCAGG + Intergenic
1090972522 11:131655578-131655600 AGGCTGTGGGCTTGGCCTGCTGG + Intronic
1092786891 12:12034530-12034552 AGCCTGTGGTATGTGCGTGCAGG + Intergenic
1093805062 12:23422002-23422024 ACCCTGAGGTCTTGCTGTACTGG + Intergenic
1099206420 12:79733474-79733496 AGTCTGTGGTATTGGTGGACAGG + Intergenic
1102512484 12:113425200-113425222 AGCCTGTGCTCTTGGGGTCCAGG + Intronic
1103737309 12:123068800-123068822 AGCCTATGGTGTTGGGGTGGTGG - Intronic
1104104962 12:125650406-125650428 AGGCTCTGGTCTTGGCGTCCTGG - Intronic
1104688948 12:130809999-130810021 GACCTGGGGTCTTGCTGTGCTGG - Intronic
1107261115 13:38492714-38492736 AGCATGTGGTCTATGTGAGCTGG + Intergenic
1107446957 13:40478194-40478216 AGGCTGTTGTTTTTGTGTGCAGG - Intergenic
1110336981 13:74344845-74344867 AGGCTGTGGTATAGTTGTGCTGG + Intergenic
1119979163 14:79059949-79059971 TGCCTCTGGCCTTGGTTTGCAGG + Intronic
1121315351 14:92958084-92958106 ACCCTGTGTTCTTGGTGGGATGG - Intronic
1121842833 14:97149176-97149198 AGCCTGTGCTCCTGCCGTGCTGG - Intergenic
1122261563 14:100526250-100526272 ACCCTGTGGGGTTGCTGTGCTGG - Intronic
1122408941 14:101516381-101516403 TGCTTGTGGTTTTGGTGGGCAGG + Intergenic
1122451870 14:101815422-101815444 TGCGTATGTTCTTGGTGTGCAGG + Intronic
1123060446 14:105592001-105592023 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123084924 14:105712972-105712994 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123412661 15:20073059-20073081 ACCCTGTGGACTTGGGGAGCGGG + Intergenic
1123522003 15:21080172-21080194 ACCCTGTGGACTTGGGGAGCGGG + Intergenic
1124235180 15:27983889-27983911 AGCCTAGGGCCTTGGTGTCCAGG - Intronic
1125693445 15:41615636-41615658 GGCCTGTGGGCTGGGTGTGGTGG + Intergenic
1129094055 15:73183709-73183731 ATCCTGTGGTATTGGTATGCTGG + Intronic
1129832712 15:78681234-78681256 AGTCTGGGGGCTTGGTATGCAGG + Intronic
1132453817 16:11669-11691 ATGCTGTGGTCTTGATCTGCAGG + Intergenic
1132516110 16:366766-366788 AGGCTGTGGTCTGGCTCTGCAGG - Intergenic
1132932166 16:2464337-2464359 AGCCTGGGGTCTGTGTGTGTGGG + Intronic
1134096250 16:11420849-11420871 TGCCTGTGTACTGGGTGTGCGGG + Intronic
1138217132 16:55214376-55214398 AGCCTGGGGTCTTAGAGTGCAGG - Intergenic
1140438212 16:74966143-74966165 TGCATGTAGTCTTGGTGTGGGGG - Intronic
1142212907 16:88816808-88816830 AGCCTGGGCTCCTGCTGTGCGGG - Intronic
1142297274 16:89232673-89232695 ATCCTGGGGTCTTGCTGTGGGGG + Exonic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144781996 17:17813009-17813031 AGTCTGTGGACTTTGTGTGTGGG - Intronic
1145902395 17:28497250-28497272 AGCCTAGGGGCTTGGTGTGGTGG - Exonic
1148004254 17:44412803-44412825 AGGCTGTGATTTTGGTATGCAGG - Intronic
1148427346 17:47610667-47610689 AGCCGGGGGTCTGGGTGTGGTGG - Intronic
1148992631 17:51679722-51679744 AGCCTGTGTTCCTGGTCTGAGGG + Intronic
1149008519 17:51830896-51830918 GGCCTGTGGTCTAGCTGTGAAGG - Intronic
1151366147 17:73617559-73617581 AGCCTGTCGACTAGGTATGCTGG - Intronic
1151520633 17:74626901-74626923 ACCCTGTTGTCTTGGTGTATTGG - Intergenic
1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG + Intronic
1153868791 18:9297351-9297373 CGCCTGTGGCCCTGGTGGGCAGG + Intergenic
1154412592 18:14149366-14149388 ACCCTATGGTCCTGGGGTGCAGG + Intergenic
1155406209 18:25490677-25490699 AGGATGTGGTGTTGCTGTGCTGG - Intergenic
1157720108 18:49917019-49917041 AGCCTGTGGTCTTCATGAGTGGG - Intronic
1160170138 18:76546018-76546040 AGGTTGTGGTCTTGGACTGCAGG - Intergenic
1161229086 19:3163493-3163515 AACCTGTGGACTAGGGGTGCAGG + Exonic
1161889029 19:7020201-7020223 AGCGTGAGGTCTTGGTGAACAGG - Intergenic
1161890336 19:7031812-7031834 AGCGTGAGGTCTTGGTGAACAGG + Intronic
1161891112 19:7038921-7038943 AGCGTGAGGTCTTGGTGAACAGG - Intronic
1161892425 19:7050548-7050570 AGCGTGAGGTCTTGGTGAACAGG + Intronic
1161893197 19:7057382-7057404 AGCGTGAGGTCTTGGTGAACAGG - Intronic
1163054031 19:14705293-14705315 AGGCTGTGGGCTTGGGGTGGTGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1166357405 19:42235344-42235366 AGCCAGTGGTTTTGGTGAGGGGG - Intronic
926814084 2:16783148-16783170 AGCCTGGGGCCATGGTGGGCTGG - Intergenic
928208636 2:29306291-29306313 AGCCTGTGGGCTTAGTGCCCAGG - Intronic
928435761 2:31253615-31253637 AGCCTGAGGTCTTGGAGCCCTGG - Intronic
928767896 2:34670285-34670307 AGCCGGTGGACTTGGGGTGCAGG + Intergenic
929556644 2:42929727-42929749 ACCCTGTGTTTTAGGTGTGCTGG - Intergenic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
931334817 2:61328867-61328889 AGCCTGTGGACTTGAAGAGCAGG - Intronic
932492535 2:72131370-72131392 AGCCTGTGTTCTAGCTGTCCTGG - Exonic
932571185 2:72939195-72939217 CGCCTCTTGCCTTGGTGTGCTGG + Intergenic
935029872 2:99311580-99311602 AGCCTGAGGGCTGGGTGTGGTGG - Intronic
936569295 2:113601429-113601451 ATGCTGTGGTCTTGATCTGCAGG - Intergenic
937100124 2:119262100-119262122 GGCCTGTGGTCTGGGTGACCTGG - Intronic
937307363 2:120880610-120880632 AGCCTGTGGTTTTTCTGTCCAGG + Intronic
937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG + Intronic
938571885 2:132568889-132568911 AGCCAGTGGCCTTGCTGGGCAGG + Intronic
940504922 2:154541170-154541192 AGCCTGTGCTCTTTTTGTGTGGG - Intergenic
943942607 2:194019534-194019556 AGCCTGTCTTCTTGGCTTGCAGG - Intergenic
944137151 2:196412266-196412288 AGCCTCTTTCCTTGGTGTGCAGG + Intronic
947919891 2:233860789-233860811 AGCCTCTTGTCTTGGCTTGCAGG + Intergenic
947943132 2:234076107-234076129 AGTCTGGGGTCTTGCTGTGCTGG + Intronic
1169388918 20:5173736-5173758 AGCCCGTGGTCTTGCAGAGCAGG + Intronic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1171124952 20:22594159-22594181 AGCCTGTGGTCATGGTTAGCAGG + Intergenic
1171385080 20:24764435-24764457 AGCCTGTGGGCTTGGAGGTCAGG + Intergenic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1173552977 20:43946263-43946285 AGGCTGTGGCCTTGGTGCCCAGG + Intronic
1175008880 20:55714458-55714480 AGCCTGTGGTCTTGGTGCCTAGG - Intergenic
1175224283 20:57435886-57435908 AGCCTGTGGTTCTGGAATGCGGG + Intergenic
1175243138 20:57564403-57564425 TGCCAGAGGCCTTGGTGTGCCGG + Intronic
1175525790 20:59632469-59632491 CGGCTGTGGGCTTGGAGTGCTGG + Intronic
1176860413 21:14008889-14008911 ACCCTATGGTCCTGGGGTGCGGG - Intergenic
1180056100 21:45359948-45359970 TGCAGGTGGTCTTGGTGTCCAGG + Intergenic
1181036453 22:20171944-20171966 AGGCTGTGGTCTAGGCGTGAAGG - Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183323915 22:37181109-37181131 GGCCTGTGTTCTGGGTGTTCAGG - Exonic
1183341747 22:37285266-37285288 AGCCTGTGGGCTTGGGGTGGGGG + Intronic
1183457530 22:37930737-37930759 AGCCTGGGCTCTGGGTGTGTGGG + Intronic
1184546432 22:45172252-45172274 AGAGTGTGGTCTTGGTGGCCTGG + Intronic
1184636734 22:45838333-45838355 ACGCTGTGGTCTTGGTGGCCTGG + Intronic
950898336 3:16473902-16473924 TGCCTGTGGTCCTGGTGACCTGG + Intronic
952392241 3:32890656-32890678 CGCCTGTGGCCTTGGTGAGTGGG - Exonic
953094108 3:39757835-39757857 AGCTTTTGGTCTTGATGTGGAGG - Intergenic
953217165 3:40930425-40930447 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
954696708 3:52431293-52431315 AGCCTGTCCTCTTTGTGGGCTGG - Intergenic
957625752 3:82650520-82650542 TCCCTGTGCTCTTGGTGGGCTGG + Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
960733003 3:120746506-120746528 ATCCTGTGGGCTGGGTGTGGTGG + Intronic
960840970 3:121958198-121958220 AGCCAGTGGACTTGGGGGGCAGG + Intergenic
964151596 3:153532015-153532037 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
966404619 3:179583690-179583712 AGACTGAGCCCTTGGTGTGCAGG - Intronic
966896774 3:184450911-184450933 AGCCTGTGCCATTGGTCTGCAGG + Intronic
966945900 3:184776942-184776964 AGCCTGAGGCCTTGGTCTCCTGG - Intergenic
967094220 3:186163410-186163432 GGCCTCTGGTCTGGGTGAGCAGG + Intronic
967929331 3:194679335-194679357 AGCCTGTGTTCTTTGTGTTTGGG - Intergenic
967955821 3:194876647-194876669 AGGATGTGGTCATGGGGTGCGGG - Intergenic
968703363 4:2067019-2067041 AGCCACGGGTCTTGCTGTGCTGG + Exonic
968974433 4:3813726-3813748 AGCGTGTGGTCCTGGAGCGCTGG - Intergenic
969521482 4:7680335-7680357 AGACTCTGGCCTTGGTCTGCAGG - Intronic
969857048 4:10008323-10008345 AGCCTGGGGCGTTGGTGTCCAGG - Intronic
976493826 4:85703174-85703196 AGTCTATGGTCTTGGTGACCAGG - Intronic
982091950 4:151887965-151887987 AGTCAGTGGTGTTGGTGTGTTGG + Intergenic
989489888 5:42037940-42037962 ACCCTGCAGTCTTGGTGTGTTGG + Intergenic
997703313 5:135922225-135922247 ATACTGTAGTCTAGGTGTGCAGG + Intergenic
998585883 5:143427302-143427324 AGTCTGTGGTCTTAGTATGTGGG + Intronic
999195710 5:149780187-149780209 AGCCTGTGCTCTGGGTGTGTGGG - Intronic
1000170808 5:158701531-158701553 AGCCTGGGCTCTTGGGATGCTGG - Intronic
1000597138 5:163229096-163229118 AGCCTGTGGTCTGGAACTGCTGG - Intergenic
1005205281 6:23395796-23395818 AGCATGTCCTCTTCGTGTGCAGG + Intergenic
1006147916 6:31970286-31970308 GACCTGTGGTCTTGGTGTTTGGG + Intronic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1007575978 6:42925459-42925481 AGGCTGGGGTCTGGGTGAGCTGG - Exonic
1007990697 6:46252278-46252300 CTTCTGTGGTCTTGATGTGCAGG + Intronic
1011838174 6:91459468-91459490 AGACAGTGGCCTTGGTGTTCAGG + Intergenic
1015992760 6:138964129-138964151 GCAATGTGGTCTTGGTGTGCAGG - Intronic
1016190603 6:141260776-141260798 TCCCTGTGGTCTTGGGGGGCCGG + Intergenic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1017928287 6:158929601-158929623 TGCCAGTGGACTTGGTGTGTGGG + Intergenic
1020131308 7:5560081-5560103 AGTCTGTGGGCTGGGTGTGGTGG + Intronic
1023663158 7:42491347-42491369 TGCCAGTGACCTTGGTGTGCAGG + Intergenic
1023844291 7:44112365-44112387 ACCCTGGGGTCCTGGTGTTCTGG + Intronic
1024291192 7:47805736-47805758 GGCCTCTGGTCTTGGGGTCCTGG - Intronic
1025836689 7:65101033-65101055 AGGCTGTGATATTCGTGTGCAGG - Intergenic
1025906464 7:65790470-65790492 AGGCTGTGATATTCGTGTGCAGG - Intergenic
1026213857 7:68330828-68330850 ACCCTGCTGTCTTGGTGTGTTGG + Intergenic
1026769435 7:73185530-73185552 AGGCTGTGATATTTGTGTGCAGG - Intergenic
1026794716 7:73359084-73359106 AGCCCGGGGTGTTGGGGTGCAGG - Intergenic
1027010304 7:74738914-74738936 AGGCTGTGATATTTGTGTGCAGG - Intronic
1027077738 7:75207125-75207147 AGGCTGTGATATTTGTGTGCAGG + Intergenic
1027630387 7:80597068-80597090 AGCCTGTTGTTTTGTTGTGCTGG + Intronic
1027819142 7:83021277-83021299 ACCCTGTTGTCTTGGTGTATTGG + Intronic
1028791648 7:94860237-94860259 ATCCTGTGGGCCTGGTGTGGTGG - Intergenic
1028972501 7:96875072-96875094 AGCCAGTGGACTTGGATTGCAGG + Intergenic
1036169425 8:6468369-6468391 AGCCTGCGGTCTGGGTGTGTGGG - Intronic
1036653670 8:10661991-10662013 AGCCCGAAGGCTTGGTGTGCAGG - Intronic
1037119636 8:15267242-15267264 AGCCTGAAGTCTCGGTCTGCAGG - Intergenic
1037839467 8:22233392-22233414 AGGGTGAGGTCTTGGTGAGCAGG + Intergenic
1040930859 8:52733703-52733725 AGGCTGGGGTCTTAGTCTGCAGG - Intronic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1043531982 8:81161200-81161222 AGCCTGTGTTCTGGGTGAGGAGG + Intergenic
1046070482 8:109247051-109247073 AGTCTGTGGTCTCTGTGTGCTGG - Intronic
1047078135 8:121427841-121427863 ATCCTGTGGTGTTGCTGTGGTGG - Intergenic
1048153710 8:131920350-131920372 TGCTTGTGGTCTTGGTATGCAGG + Intronic
1048955807 8:139535001-139535023 AGCCAGGTGTCTTGGAGTGCAGG + Intergenic
1049883233 9:12101-12123 ATGCTGTGGTCTTGATCTGCAGG + Intergenic
1053173647 9:35907667-35907689 AGGCTGTGGTGCTGGGGTGCAGG + Intergenic
1056639365 9:88357538-88357560 TGCCTATGGACTTGGTGTCCTGG + Intergenic
1056750550 9:89347795-89347817 AGCCTGTGGTGTAGGTGCTCAGG + Intronic
1056778119 9:89528902-89528924 AGTCTGTGGGCTTGCTGTCCTGG - Intergenic
1057798329 9:98173827-98173849 AGCCTTTGGTCTGGGTGTGGTGG + Intronic
1060496878 9:124125696-124125718 AGCCTTTGTTCTTGGTGGGTCGG + Intergenic
1060810599 9:126609818-126609840 TGTCTGTGGTCTTGCTGTGCCGG - Intergenic
1062231009 9:135481095-135481117 ACCGTGTGGCCTTGGGGTGCAGG + Intronic
1186316422 X:8375279-8375301 ACCCTGTTGTCTTGGTGGGTTGG + Intergenic
1187070997 X:15888244-15888266 AGCCTGTGCTCTGGGTGTCCAGG - Intergenic
1187896016 X:23980314-23980336 AGGCTGTGCTCTTCATGTGCAGG - Intergenic
1188573417 X:31617245-31617267 ATACTGTGGGCTTGGTGTGGTGG + Intronic
1188797530 X:34484175-34484197 GGCCTGGGGGCTTGTTGTGCAGG + Intergenic
1190152092 X:47957291-47957313 GGCCTGTGGTGTTGATTTGCTGG + Intronic
1193486564 X:82091187-82091209 AGCCTGGGGTTTTAGTGTGGGGG + Intergenic
1196441195 X:115721511-115721533 AGCAGGTGGTCTTGGGGTGGGGG + Intergenic
1196444723 X:115839499-115839521 AGCAGGTGGTCTTGGGGTGGGGG + Intergenic
1196839550 X:119846645-119846667 TGCCTGTGCTTTTGGTGTCCTGG - Intronic
1198327315 X:135586594-135586616 AGCCAGGGGTCCTGGGGTGCCGG - Intergenic
1200402580 X:156028047-156028069 ATGCTGTGGTCTTGATCTGCAGG - Intergenic