ID: 1016952578

View in Genome Browser
Species Human (GRCh38)
Location 6:149594490-149594512
Sequence ACCAAGACCACAGGCTGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016952568_1016952578 27 Left 1016952568 6:149594440-149594462 CCCGTAGAGGGCTGCGTCACTTC 0: 1
1: 2
2: 2
3: 6
4: 46
Right 1016952578 6:149594490-149594512 ACCAAGACCACAGGCTGCCGTGG 0: 1
1: 0
2: 3
3: 33
4: 177
1016952575_1016952578 -10 Left 1016952575 6:149594477-149594499 CCGAGGCCAGCACACCAAGACCA No data
Right 1016952578 6:149594490-149594512 ACCAAGACCACAGGCTGCCGTGG 0: 1
1: 0
2: 3
3: 33
4: 177
1016952574_1016952578 -1 Left 1016952574 6:149594468-149594490 CCTTCGTGTCCGAGGCCAGCACA No data
Right 1016952578 6:149594490-149594512 ACCAAGACCACAGGCTGCCGTGG 0: 1
1: 0
2: 3
3: 33
4: 177
1016952569_1016952578 26 Left 1016952569 6:149594441-149594463 CCGTAGAGGGCTGCGTCACTTCT No data
Right 1016952578 6:149594490-149594512 ACCAAGACCACAGGCTGCCGTGG 0: 1
1: 0
2: 3
3: 33
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016952578 Original CRISPR ACCAAGACCACAGGCTGCCG TGG Intergenic