ID: 1016952582

View in Genome Browser
Species Human (GRCh38)
Location 6:149594502-149594524
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016952574_1016952582 11 Left 1016952574 6:149594468-149594490 CCTTCGTGTCCGAGGCCAGCACA No data
Right 1016952582 6:149594502-149594524 GGCTGCCGTGGCCGCATCGTGGG 0: 1
1: 0
2: 2
3: 10
4: 62
1016952577_1016952582 -4 Left 1016952577 6:149594483-149594505 CCAGCACACCAAGACCACAGGCT 0: 1
1: 0
2: 6
3: 24
4: 196
Right 1016952582 6:149594502-149594524 GGCTGCCGTGGCCGCATCGTGGG 0: 1
1: 0
2: 2
3: 10
4: 62
1016952575_1016952582 2 Left 1016952575 6:149594477-149594499 CCGAGGCCAGCACACCAAGACCA No data
Right 1016952582 6:149594502-149594524 GGCTGCCGTGGCCGCATCGTGGG 0: 1
1: 0
2: 2
3: 10
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016952582 Original CRISPR GGCTGCCGTGGCCGCATCGT GGG Intergenic