ID: 1016952583 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:149594507-149594529 |
| Sequence | ACACACCCACGATGCGGCCA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 96 | |||
| Summary | {0: 1, 1: 2, 2: 2, 3: 7, 4: 84} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1016952583_1016952585 | 0 | Left | 1016952583 | 6:149594507-149594529 | CCGTGGCCGCATCGTGGGTGTGT | 0: 1 1: 2 2: 2 3: 7 4: 84 |
||
| Right | 1016952585 | 6:149594530-149594552 | CTAAGAAGAAGTAAGTCTGTAGG | 0: 1 1: 0 2: 7 3: 12 4: 140 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1016952583 | Original CRISPR | ACACACCCACGATGCGGCCA CGG (reversed) | Intergenic | ||