ID: 1016952584 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:149594513-149594535 |
Sequence | TCTTAGACACACCCACGATG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 66 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 6, 4: 57} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1016952584_1016952585 | -6 | Left | 1016952584 | 6:149594513-149594535 | CCGCATCGTGGGTGTGTCTAAGA | 0: 1 1: 0 2: 2 3: 6 4: 57 |
||
Right | 1016952585 | 6:149594530-149594552 | CTAAGAAGAAGTAAGTCTGTAGG | 0: 1 1: 0 2: 7 3: 12 4: 140 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1016952584 | Original CRISPR | TCTTAGACACACCCACGATG CGG (reversed) | Intergenic | ||