ID: 1016952584

View in Genome Browser
Species Human (GRCh38)
Location 6:149594513-149594535
Sequence TCTTAGACACACCCACGATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016952584_1016952585 -6 Left 1016952584 6:149594513-149594535 CCGCATCGTGGGTGTGTCTAAGA 0: 1
1: 0
2: 2
3: 6
4: 57
Right 1016952585 6:149594530-149594552 CTAAGAAGAAGTAAGTCTGTAGG 0: 1
1: 0
2: 7
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016952584 Original CRISPR TCTTAGACACACCCACGATG CGG (reversed) Intergenic